Incidental Mutation 'R4021:Mroh2b'
ID 313262
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 4928219-4991687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4954582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 682 (C682S)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect possibly damaging
Transcript: ENSMUST00000045736
AA Change: C682S

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: C682S

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Meta Mutation Damage Score 0.1533 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam107b G A 2: 3,779,511 (GRCm39) R238Q probably damaging Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Farsa A G 8: 85,595,499 (GRCm39) T465A probably damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Got2 T G 8: 96,604,381 (GRCm39) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Hexd T C 11: 121,108,987 (GRCm39) probably null Het
Igf2r T A 17: 12,967,638 (GRCm39) N27I probably damaging Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lair1 A G 7: 4,058,915 (GRCm39) probably null Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4,928,679 (GRCm39) missense probably benign
IGL00507:Mroh2b APN 15 4,991,609 (GRCm39) missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4,960,798 (GRCm39) missense probably benign 0.35
IGL00902:Mroh2b APN 15 4,944,704 (GRCm39) missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4,980,609 (GRCm39) splice site probably benign
IGL00954:Mroh2b APN 15 4,932,536 (GRCm39) missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4,971,024 (GRCm39) missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4,944,634 (GRCm39) missense probably benign 0.00
IGL01337:Mroh2b APN 15 4,934,506 (GRCm39) missense probably benign 0.38
IGL01780:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL01919:Mroh2b APN 15 4,953,170 (GRCm39) missense probably benign 0.10
IGL02069:Mroh2b APN 15 4,933,806 (GRCm39) splice site probably benign
IGL02146:Mroh2b APN 15 4,980,776 (GRCm39) splice site probably null
IGL02221:Mroh2b APN 15 4,953,123 (GRCm39) missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4,981,745 (GRCm39) missense probably benign 0.04
IGL02350:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02357:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02401:Mroh2b APN 15 4,929,983 (GRCm39) missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4,981,042 (GRCm39) splice site probably benign
IGL02432:Mroh2b APN 15 4,943,668 (GRCm39) missense probably benign
IGL02582:Mroh2b APN 15 4,937,997 (GRCm39) missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4,960,583 (GRCm39) missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4,935,114 (GRCm39) missense probably benign
IGL02811:Mroh2b APN 15 4,944,718 (GRCm39) missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4,991,630 (GRCm39) missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4,973,854 (GRCm39) missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4,942,294 (GRCm39) missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4,955,109 (GRCm39) missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4,960,600 (GRCm39) missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4,971,116 (GRCm39) missense probably benign 0.01
R0530:Mroh2b UTSW 15 4,963,877 (GRCm39) missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4,947,799 (GRCm39) missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4,978,137 (GRCm39) missense probably benign 0.00
R1525:Mroh2b UTSW 15 4,980,612 (GRCm39) splice site probably null
R1584:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4,974,572 (GRCm39) missense probably benign 0.08
R1657:Mroh2b UTSW 15 4,960,525 (GRCm39) nonsense probably null
R1671:Mroh2b UTSW 15 4,980,776 (GRCm39) splice site probably null
R1698:Mroh2b UTSW 15 4,943,622 (GRCm39) missense probably benign 0.02
R2002:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4,946,640 (GRCm39) missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4,974,448 (GRCm39) missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4,950,928 (GRCm39) critical splice donor site probably null
R2183:Mroh2b UTSW 15 4,947,707 (GRCm39) splice site probably null
R3713:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3714:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3747:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3748:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3749:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3750:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3792:Mroh2b UTSW 15 4,953,102 (GRCm39) missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4,954,543 (GRCm39) nonsense probably null
R4329:Mroh2b UTSW 15 4,960,861 (GRCm39) missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4,977,407 (GRCm39) missense probably benign 0.21
R4592:Mroh2b UTSW 15 4,947,772 (GRCm39) missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4,933,752 (GRCm39) missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4,929,932 (GRCm39) missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4,971,004 (GRCm39) missense probably benign 0.07
R5342:Mroh2b UTSW 15 4,943,615 (GRCm39) nonsense probably null
R5353:Mroh2b UTSW 15 4,946,660 (GRCm39) missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4,935,054 (GRCm39) missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4,971,094 (GRCm39) missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4,938,463 (GRCm39) missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4,942,366 (GRCm39) splice site probably null
R6046:Mroh2b UTSW 15 4,980,763 (GRCm39) missense probably benign 0.01
R6081:Mroh2b UTSW 15 4,973,859 (GRCm39) missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4,944,707 (GRCm39) missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4,947,832 (GRCm39) missense probably benign 0.23
R6240:Mroh2b UTSW 15 4,964,126 (GRCm39) missense probably benign 0.38
R6487:Mroh2b UTSW 15 4,976,721 (GRCm39) missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4,935,056 (GRCm39) missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4,982,764 (GRCm39) missense probably benign 0.36
R6663:Mroh2b UTSW 15 4,977,417 (GRCm39) missense probably benign 0.21
R6820:Mroh2b UTSW 15 4,982,756 (GRCm39) missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4,938,469 (GRCm39) missense probably benign 0.00
R6990:Mroh2b UTSW 15 4,942,284 (GRCm39) missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4,929,986 (GRCm39) missense probably benign 0.35
R7092:Mroh2b UTSW 15 4,964,160 (GRCm39) missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4,977,485 (GRCm39) missense probably benign 0.06
R7264:Mroh2b UTSW 15 4,950,844 (GRCm39) missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4,971,036 (GRCm39) missense probably benign 0.21
R7462:Mroh2b UTSW 15 4,938,109 (GRCm39) missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4,978,491 (GRCm39) missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4,964,087 (GRCm39) missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4,960,543 (GRCm39) missense probably benign 0.09
R7605:Mroh2b UTSW 15 4,974,505 (GRCm39) missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4,946,613 (GRCm39) missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4,978,587 (GRCm39) missense probably benign 0.36
R7848:Mroh2b UTSW 15 4,967,861 (GRCm39) nonsense probably null
R7952:Mroh2b UTSW 15 4,980,693 (GRCm39) missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4,950,839 (GRCm39) nonsense probably null
R8088:Mroh2b UTSW 15 4,929,985 (GRCm39) missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4,967,892 (GRCm39) missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4,938,522 (GRCm39) missense probably benign 0.04
R8248:Mroh2b UTSW 15 4,960,586 (GRCm39) missense probably benign 0.40
R8258:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8259:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8304:Mroh2b UTSW 15 4,955,119 (GRCm39) missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4,980,746 (GRCm39) nonsense probably null
R8345:Mroh2b UTSW 15 4,973,808 (GRCm39) missense probably benign 0.09
R8507:Mroh2b UTSW 15 4,978,572 (GRCm39) missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4,935,122 (GRCm39) missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4,964,782 (GRCm39) missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4,978,191 (GRCm39) missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4,971,107 (GRCm39) missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4,960,510 (GRCm39) nonsense probably null
R8910:Mroh2b UTSW 15 4,960,855 (GRCm39) missense probably benign 0.01
R8913:Mroh2b UTSW 15 4,947,010 (GRCm39) intron probably benign
R8941:Mroh2b UTSW 15 4,991,606 (GRCm39) missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4,928,670 (GRCm39) start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4,982,754 (GRCm39) critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4,929,935 (GRCm39) missense probably benign 0.20
R9118:Mroh2b UTSW 15 4,991,573 (GRCm39) missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4,980,666 (GRCm39) missense probably benign
R9429:Mroh2b UTSW 15 4,963,907 (GRCm39) missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4,963,952 (GRCm39) missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4,973,821 (GRCm39) missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4,960,823 (GRCm39) missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4,950,845 (GRCm39) missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4,978,130 (GRCm39) missense probably benign 0.00
R9631:Mroh2b UTSW 15 4,946,556 (GRCm39) missense probably damaging 0.97
R9686:Mroh2b UTSW 15 4,974,605 (GRCm39) missense probably benign 0.34
R9774:Mroh2b UTSW 15 4,943,613 (GRCm39) missense probably benign 0.08
X0067:Mroh2b UTSW 15 4,981,073 (GRCm39) missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4,934,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCCTCAAAGCCATCTAAC -3'
(R):5'- AAGCTTTCTTGGTTAGCACTAGTG -3'

Sequencing Primer
(F):5'- GGGTGCTCTATTCAATATCCAGTGAC -3'
(R):5'- TGCCAAAGAAAGTGGAGTAGACTTC -3'
Posted On 2015-04-30