Mutagenetix > Incidental Mutations

Incidental Mutation 'R4021:Mroh2b'

313262

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

040955-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4925100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 682 (C682S)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045736
AA Change: C682S

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: C682S

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228458

Meta Mutation Damage Score

0.1533

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cacna2d2	C	T	9: 107,514,058	T428M	probably damaging	Het
Cdh22	T	C	2: 165,143,673	D331G	possibly damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Itgax	T	A	7: 128,133,139		probably null	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lair1	A	G	7: 4,055,916		probably null	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGCCTCAAAGCCATCTAAC -3'
(R):5'- AAGCTTTCTTGGTTAGCACTAGTG -3'

Sequencing Primer
(F):5'- GGGTGCTCTATTCAATATCCAGTGAC -3'
(R):5'- TGCCAAAGAAAGTGGAGTAGACTTC -3'

Posted On

2015-04-30