Incidental Mutation 'R4021:Igf2r'
ID 313266
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 040955-MU
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127
Essential gene? Probably essential (E-score: 0.875) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12748751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 27 (N27I)
Ref Sequence ENSEMBL: ENSMUSP00000124679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599] [ENSMUST00000159127] [ENSMUST00000162982]
AlphaFold Q07113
Predicted Effect probably benign
Transcript: ENSMUST00000024599
AA Change: N56I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: N56I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079529
Predicted Effect probably benign
Transcript: ENSMUST00000159127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162826
Predicted Effect probably damaging
Transcript: ENSMUST00000162982
AA Change: N27I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124679
Gene: ENSMUSG00000023830
AA Change: N27I

DomainStartEndE-ValueType
PDB:1SZ0|B 17 58 3e-16 PDB
Meta Mutation Damage Score 0.2421 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
blunt UTSW 17 12722175 missense probably benign 0.02
brusque UTSW 17 12714951 missense probably damaging 0.98
gruff UTSW 17 12684097 missense probably damaging 0.96
outlier UTSW 17 12695314 missense probably benign 0.20
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8220:Igf2r UTSW 17 12692071 missense probably benign 0.22
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
R8500:Igf2r UTSW 17 12709441 missense probably damaging 0.99
R8510:Igf2r UTSW 17 12704313 missense probably benign 0.38
R8933:Igf2r UTSW 17 12701244 missense probably damaging 0.97
R8933:Igf2r UTSW 17 12704637 missense probably damaging 1.00
R8976:Igf2r UTSW 17 12726772 missense probably damaging 1.00
R8994:Igf2r UTSW 17 12716650 missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12751293 start codon destroyed probably null
R9097:Igf2r UTSW 17 12691213 missense probably damaging 1.00
R9127:Igf2r UTSW 17 12739351 missense probably damaging 0.98
R9278:Igf2r UTSW 17 12695353 missense probably damaging 1.00
R9362:Igf2r UTSW 17 12722175 missense probably benign 0.02
R9371:Igf2r UTSW 17 12705759 missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12698328 missense probably benign 0.26
R9567:Igf2r UTSW 17 12686754 missense probably damaging 1.00
R9665:Igf2r UTSW 17 12694140 missense probably benign 0.17
R9666:Igf2r UTSW 17 12726701 missense probably benign
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCATGCAGCTGTGTACAC -3'
(R):5'- ACAAACATGGGGTTGTGTAGTCTG -3'

Sequencing Primer
(F):5'- GTACACAGCTGTACCGCAG -3'
(R):5'- GCCATCTTGAACTCCTTTCCAAAATG -3'
Posted On 2015-04-30