Incidental Mutation 'R4021:Igf2r'
ID 313266
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 12901293-12988551 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12967638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 27 (N27I)
Ref Sequence ENSEMBL: ENSMUSP00000124679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599] [ENSMUST00000159127] [ENSMUST00000162982]
AlphaFold Q07113
Predicted Effect probably benign
Transcript: ENSMUST00000024599
AA Change: N56I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: N56I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079529
Predicted Effect probably benign
Transcript: ENSMUST00000159127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160932
Predicted Effect probably damaging
Transcript: ENSMUST00000162982
AA Change: N27I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124679
Gene: ENSMUSG00000023830
AA Change: N27I

DomainStartEndE-ValueType
PDB:1SZ0|B 17 58 3e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162826
Meta Mutation Damage Score 0.2421 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam107b G A 2: 3,779,511 (GRCm39) R238Q probably damaging Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Farsa A G 8: 85,595,499 (GRCm39) T465A probably damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Got2 T G 8: 96,604,381 (GRCm39) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Hexd T C 11: 121,108,987 (GRCm39) probably null Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lair1 A G 7: 4,058,915 (GRCm39) probably null Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mroh2b T A 15: 4,954,582 (GRCm39) C682S possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,932,877 (GRCm39) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,958,215 (GRCm39) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,919,245 (GRCm39) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,902,754 (GRCm39) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,923,662 (GRCm39) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,914,261 (GRCm39) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,923,236 (GRCm39) missense probably benign
IGL01557:Igf2r APN 17 12,923,522 (GRCm39) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,902,872 (GRCm39) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,944,302 (GRCm39) nonsense probably null
IGL01720:Igf2r APN 17 12,920,200 (GRCm39) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,902,709 (GRCm39) missense probably benign
IGL01839:Igf2r APN 17 12,923,909 (GRCm39) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,933,798 (GRCm39) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,923,225 (GRCm39) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,912,079 (GRCm39) nonsense probably null
IGL02095:Igf2r APN 17 12,920,892 (GRCm39) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,917,403 (GRCm39) unclassified probably benign
IGL02576:Igf2r APN 17 12,967,650 (GRCm39) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,930,974 (GRCm39) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,938,770 (GRCm39) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,911,610 (GRCm39) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,913,007 (GRCm39) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,929,633 (GRCm39) splice site probably benign
IGL03080:Igf2r APN 17 12,945,563 (GRCm39) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,935,559 (GRCm39) missense probably damaging 1.00
blunt UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
brusque UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
gruff UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
outlier UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
NA:Igf2r UTSW 17 12,910,849 (GRCm39) missense probably benign
R0165:Igf2r UTSW 17 12,917,414 (GRCm39) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,902,835 (GRCm39) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,910,951 (GRCm39) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,936,161 (GRCm39) splice site probably null
R0722:Igf2r UTSW 17 12,934,382 (GRCm39) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,910,988 (GRCm39) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,913,011 (GRCm39) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,936,156 (GRCm39) splice site probably benign
R1485:Igf2r UTSW 17 12,910,172 (GRCm39) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,945,196 (GRCm39) missense probably benign
R1693:Igf2r UTSW 17 12,923,203 (GRCm39) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,916,328 (GRCm39) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,923,157 (GRCm39) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,952,790 (GRCm39) nonsense probably null
R1994:Igf2r UTSW 17 12,911,625 (GRCm39) missense probably benign
R2060:Igf2r UTSW 17 12,920,206 (GRCm39) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,917,138 (GRCm39) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,941,095 (GRCm39) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,934,830 (GRCm39) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,941,198 (GRCm39) splice site probably null
R2696:Igf2r UTSW 17 12,914,231 (GRCm39) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,928,355 (GRCm39) missense probably benign
R3930:Igf2r UTSW 17 12,924,716 (GRCm39) missense probably benign 0.01
R4125:Igf2r UTSW 17 12,921,141 (GRCm39) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,922,352 (GRCm39) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,903,013 (GRCm39) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,920,240 (GRCm39) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,910,764 (GRCm39) splice site probably null
R4980:Igf2r UTSW 17 12,922,247 (GRCm39) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,944,303 (GRCm39) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,912,032 (GRCm39) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,958,221 (GRCm39) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,936,254 (GRCm39) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,917,239 (GRCm39) splice site probably null
R5794:Igf2r UTSW 17 12,928,332 (GRCm39) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,933,000 (GRCm39) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,902,787 (GRCm39) missense probably benign
R6396:Igf2r UTSW 17 12,932,977 (GRCm39) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,920,137 (GRCm39) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6591:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,917,505 (GRCm39) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6691:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,933,831 (GRCm39) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,932,969 (GRCm39) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,922,263 (GRCm39) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,916,228 (GRCm39) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,937,605 (GRCm39) missense probably benign
R7030:Igf2r UTSW 17 12,952,753 (GRCm39) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,917,212 (GRCm39) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,923,210 (GRCm39) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,933,003 (GRCm39) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,922,371 (GRCm39) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,917,115 (GRCm39) nonsense probably null
R7463:Igf2r UTSW 17 12,929,532 (GRCm39) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,917,160 (GRCm39) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,954,878 (GRCm39) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,958,256 (GRCm39) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,967,591 (GRCm39) missense probably benign
R8022:Igf2r UTSW 17 12,937,682 (GRCm39) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,920,125 (GRCm39) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,910,958 (GRCm39) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,952,747 (GRCm39) missense probably benign
R8359:Igf2r UTSW 17 12,902,748 (GRCm39) missense probably benign
R8500:Igf2r UTSW 17 12,928,328 (GRCm39) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,923,200 (GRCm39) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,923,524 (GRCm39) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,920,131 (GRCm39) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,945,659 (GRCm39) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,935,537 (GRCm39) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,970,180 (GRCm39) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,910,100 (GRCm39) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,958,238 (GRCm39) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,914,240 (GRCm39) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,924,646 (GRCm39) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,917,215 (GRCm39) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,905,641 (GRCm39) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,913,027 (GRCm39) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,945,588 (GRCm39) missense probably benign
X0028:Igf2r UTSW 17 12,923,800 (GRCm39) nonsense probably null
Z1177:Igf2r UTSW 17 12,916,286 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCATGCAGCTGTGTACAC -3'
(R):5'- ACAAACATGGGGTTGTGTAGTCTG -3'

Sequencing Primer
(F):5'- GTACACAGCTGTACCGCAG -3'
(R):5'- GCCATCTTGAACTCCTTTCCAAAATG -3'
Posted On 2015-04-30