Incidental Mutation 'R4021:Gtf2h4'
ID313268
Institutional Source Beutler Lab
Gene Symbol Gtf2h4
Ensembl Gene ENSMUSG00000001524
Gene Namegeneral transcription factor II H, polypeptide 4
Synonymsp52
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35667730-35673739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35670664 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 186 (M186V)
Ref Sequence ENSEMBL: ENSMUSP00000124335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000159852] [ENSMUST00000160039] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000162266] [ENSMUST00000165144]
Predicted Effect probably benign
Transcript: ENSMUST00000001565
AA Change: M186V

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524
AA Change: M186V

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000043674
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159671
Predicted Effect probably benign
Transcript: ENSMUST00000159852
SMART Domains Protein: ENSMUSP00000124060
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 61 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160039
SMART Domains Protein: ENSMUSP00000124683
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 164 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160711
Predicted Effect probably benign
Transcript: ENSMUST00000160734
AA Change: M186V

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524
AA Change: M186V

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect silent
Transcript: ENSMUST00000160752
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162266
SMART Domains Protein: ENSMUSP00000124103
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 91 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162927
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Meta Mutation Damage Score 0.2505 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a subunit of the general transcription factor multiprotein complex that plays roles in basal transcription, DNA repair and cell cycle control. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Gtf2h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Gtf2h4 APN 17 35669982 missense probably damaging 1.00
IGL03412:Gtf2h4 APN 17 35668483 missense probably damaging 0.98
miramont UTSW 17 32345378 missense probably damaging 0.97
R0112:Gtf2h4 UTSW 17 35670448 missense possibly damaging 0.93
R0554:Gtf2h4 UTSW 17 35668639 missense probably benign 0.06
R0928:Gtf2h4 UTSW 17 35670885 missense probably damaging 1.00
R1917:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R1918:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R2264:Gtf2h4 UTSW 17 35668664 unclassified probably benign
R2287:Gtf2h4 UTSW 17 35671225 critical splice donor site probably null
R2357:Gtf2h4 UTSW 17 35667999 missense probably damaging 1.00
R2519:Gtf2h4 UTSW 17 35670909 missense probably damaging 1.00
R4881:Gtf2h4 UTSW 17 35670233 missense possibly damaging 0.94
R5747:Gtf2h4 UTSW 17 35670381 missense possibly damaging 0.66
R5889:Gtf2h4 UTSW 17 35670900 missense possibly damaging 0.51
R6356:Gtf2h4 UTSW 17 35669755 missense probably damaging 0.99
R7323:Gtf2h4 UTSW 17 35669965 missense probably damaging 0.99
R7426:Gtf2h4 UTSW 17 35669358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGGTTCAGTGCTAGAC -3'
(R):5'- CTCACTGGACAAGTATGCTGAGG -3'

Sequencing Primer
(F):5'- CTAGACACAGAGCGGGCTG -3'
(R):5'- AGTGTGCCTCTGCTGTGC -3'
Posted On2015-04-30