Incidental Mutation 'R4021:Cyp2c55'
ID313271
Institutional Source Beutler Lab
Gene Symbol Cyp2c55
Ensembl Gene ENSMUSG00000025002
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms2010318C06Rik
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4021 (G1)
Quality Score210
Status Validated
Chromosome19
Chromosomal Location39007019-39042693 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 39035434 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025966] [ENSMUST00000025966]
Predicted Effect probably null
Transcript: ENSMUST00000025966
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025966
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Cyp2c55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c55 APN 19 39011746 missense probably benign 0.41
IGL00537:Cyp2c55 APN 19 39011706 missense possibly damaging 0.93
IGL00959:Cyp2c55 APN 19 39038143 missense probably benign 0.00
IGL01140:Cyp2c55 APN 19 39018649 missense probably benign
IGL01792:Cyp2c55 APN 19 39042187 missense probably benign
PIT4453001:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R0472:Cyp2c55 UTSW 19 39031379 missense probably benign 0.01
R1452:Cyp2c55 UTSW 19 39011090 missense probably damaging 1.00
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1925:Cyp2c55 UTSW 19 39034377 missense probably benign 0.06
R2154:Cyp2c55 UTSW 19 39034375 missense probably damaging 1.00
R3814:Cyp2c55 UTSW 19 39007065 missense probably damaging 1.00
R4022:Cyp2c55 UTSW 19 39035434 splice site probably null
R4293:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4294:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4604:Cyp2c55 UTSW 19 39031386 missense possibly damaging 0.82
R4740:Cyp2c55 UTSW 19 39018729 missense probably benign
R4756:Cyp2c55 UTSW 19 39031371 missense probably damaging 1.00
R4879:Cyp2c55 UTSW 19 39042078 frame shift probably null
R5039:Cyp2c55 UTSW 19 39038143 missense probably benign 0.00
R5672:Cyp2c55 UTSW 19 39035546 missense probably benign 0.02
R5834:Cyp2c55 UTSW 19 39042067 missense probably benign 0.00
R6198:Cyp2c55 UTSW 19 39007121 nonsense probably null
R6255:Cyp2c55 UTSW 19 39018667 missense probably benign 0.25
R6431:Cyp2c55 UTSW 19 39031409 missense probably damaging 0.99
R6565:Cyp2c55 UTSW 19 39042122 missense probably benign 0.09
R7934:Cyp2c55 UTSW 19 39042091 missense probably damaging 1.00
R8477:Cyp2c55 UTSW 19 39011041 missense probably damaging 0.97
R8865:Cyp2c55 UTSW 19 39031434 missense probably benign 0.21
R8904:Cyp2c55 UTSW 19 39034372 missense
R8960:Cyp2c55 UTSW 19 39007103 missense probably null 1.00
X0062:Cyp2c55 UTSW 19 39018689 missense probably damaging 0.98
Z1176:Cyp2c55 UTSW 19 39035513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATTCAGATATGCACAAACACATGC -3'
(R):5'- AACATTACAGGTAGCTGCATGG -3'

Sequencing Primer
(F):5'- ACATTCCTGGTGTTCACAGGGAC -3'
(R):5'- GCATGGGGCACATTGTTG -3'
Posted On2015-04-30