Incidental Mutation 'R4022:Zfp488'
ID313317
Institutional Source Beutler Lab
Gene Symbol Zfp488
Ensembl Gene ENSMUSG00000044519
Gene Namezinc finger protein 488
SynonymsLOC382867
MMRRC Submission 040956-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4022 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33967070-33978764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33971153 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 18 (M18L)
Ref Sequence ENSEMBL: ENSMUSP00000132436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166737]
Predicted Effect probably benign
Transcript: ENSMUST00000166737
AA Change: M18L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132436
Gene: ENSMUSG00000044519
AA Change: M18L

DomainStartEndE-ValueType
low complexity region 161 175 N/A INTRINSIC
low complexity region 244 270 N/A INTRINSIC
ZnF_C2H2 272 294 2.89e1 SMART
ZnF_C2H2 314 336 5.06e-2 SMART
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T A 2: 26,843,800 Y131F probably damaging Het
Adcy4 C T 14: 55,775,178 probably null Het
Ago3 T A 4: 126,368,593 N388I probably benign Het
Arfgef2 G T 2: 166,873,945 V1385L probably benign Het
Camk2a A T 18: 60,963,928 K28* probably null Het
Ccdc180 T A 4: 45,904,560 Y385* probably null Het
Cd209g A T 8: 4,135,955 Q46L possibly damaging Het
Cdh22 T C 2: 165,157,253 T220A probably benign Het
Cltc A T 11: 86,720,348 C562S probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
D17Wsu92e T C 17: 27,786,262 E107G probably damaging Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dhx30 T C 9: 110,084,397 D1223G possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Erbb2 T G 11: 98,435,297 C966W probably benign Het
Exoc1 C T 5: 76,549,570 T405I possibly damaging Het
Fbxo28 T C 1: 182,329,910 N108S possibly damaging Het
Fhdc1 T C 3: 84,445,102 E157G probably benign Het
Gstcd C T 3: 133,082,068 V290M probably damaging Het
Hps3 A G 3: 20,035,261 V2A possibly damaging Het
Itsn2 G A 12: 4,624,927 R23H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lax1 C T 1: 133,683,036 G105S probably benign Het
Lin7c G T 2: 109,896,445 probably null Het
Lrrn2 T C 1: 132,939,114 V639A probably benign Het
Luzp1 T C 4: 136,542,193 S576P probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mast4 G T 13: 102,853,869 A48E probably damaging Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Megf8 T C 7: 25,337,775 V700A probably damaging Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Myh2 G T 11: 67,179,404 E421* probably null Het
Olfr102 T A 17: 37,314,274 I37L probably benign Het
Olfr181 T C 16: 58,926,120 I150M possibly damaging Het
Pecam1 T C 11: 106,655,160 N693D probably benign Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prune2 A G 19: 17,000,020 T40A probably damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Reln T C 5: 22,227,630 Q124R probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sall3 T A 18: 80,969,840 E1127V probably benign Het
Sertad3 A G 7: 27,476,695 N185D probably damaging Het
Sox1 A G 8: 12,396,719 Y120C probably damaging Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Spg20 G T 3: 55,117,736 V251L probably damaging Het
Stard9 A G 2: 120,704,155 E3631G probably benign Het
Syde2 A G 3: 146,015,725 T848A probably benign Het
Tmem11 T C 11: 60,865,328 D12G possibly damaging Het
Trim28 T C 7: 13,028,558 probably benign Het
Tsen2 T A 6: 115,547,987 V49E probably damaging Het
Tspan1 C T 4: 116,167,035 M10I probably benign Het
Uncx A T 5: 139,546,689 T170S probably damaging Het
Usp24 T C 4: 106,379,224 probably benign Het
Vmn1r84 T C 7: 12,361,930 I267V probably benign Het
Other mutations in Zfp488
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Zfp488 APN 14 33971069 missense probably benign 0.00
IGL02156:Zfp488 APN 14 33970400 missense possibly damaging 0.83
IGL02668:Zfp488 APN 14 33970820 missense probably benign 0.01
R0504:Zfp488 UTSW 14 33970540 missense probably damaging 0.97
R4021:Zfp488 UTSW 14 33971153 missense probably benign 0.01
R4291:Zfp488 UTSW 14 33970894 missense possibly damaging 0.83
R6180:Zfp488 UTSW 14 33970794 missense possibly damaging 0.66
R6927:Zfp488 UTSW 14 33970798 missense probably benign
R7687:Zfp488 UTSW 14 33970400 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAGGCTCAGTTCAGTATAGGC -3'
(R):5'- TGTTTGGTGTCGCCCTATAC -3'

Sequencing Primer
(F):5'- CAGTTCAGTATAGGCCTCATCTTGG -3'
(R):5'- GGAATAACCAGTGCCCGC -3'
Posted On2015-04-30