Incidental Mutation 'R4022:Rnf17'
ID313319
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 040956-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R4022 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56460001 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 451 (H451Y)
Ref Sequence ENSEMBL: ENSMUSP00000153222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably damaging
Transcript: ENSMUST00000095793
AA Change: H451Y

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: H451Y

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223627
AA Change: H451Y

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225621
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T A 2: 26,843,800 Y131F probably damaging Het
Adcy4 C T 14: 55,775,178 probably null Het
Ago3 T A 4: 126,368,593 N388I probably benign Het
Arfgef2 G T 2: 166,873,945 V1385L probably benign Het
Camk2a A T 18: 60,963,928 K28* probably null Het
Ccdc180 T A 4: 45,904,560 Y385* probably null Het
Cd209g A T 8: 4,135,955 Q46L possibly damaging Het
Cdh22 T C 2: 165,157,253 T220A probably benign Het
Cltc A T 11: 86,720,348 C562S probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
D17Wsu92e T C 17: 27,786,262 E107G probably damaging Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dhx30 T C 9: 110,084,397 D1223G possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Erbb2 T G 11: 98,435,297 C966W probably benign Het
Exoc1 C T 5: 76,549,570 T405I possibly damaging Het
Fbxo28 T C 1: 182,329,910 N108S possibly damaging Het
Fhdc1 T C 3: 84,445,102 E157G probably benign Het
Gstcd C T 3: 133,082,068 V290M probably damaging Het
Hps3 A G 3: 20,035,261 V2A possibly damaging Het
Itsn2 G A 12: 4,624,927 R23H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lax1 C T 1: 133,683,036 G105S probably benign Het
Lin7c G T 2: 109,896,445 probably null Het
Lrrn2 T C 1: 132,939,114 V639A probably benign Het
Luzp1 T C 4: 136,542,193 S576P probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mast4 G T 13: 102,853,869 A48E probably damaging Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Megf8 T C 7: 25,337,775 V700A probably damaging Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Myh2 G T 11: 67,179,404 E421* probably null Het
Olfr102 T A 17: 37,314,274 I37L probably benign Het
Olfr181 T C 16: 58,926,120 I150M possibly damaging Het
Pecam1 T C 11: 106,655,160 N693D probably benign Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prune2 A G 19: 17,000,020 T40A probably damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Reln T C 5: 22,227,630 Q124R probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sall3 T A 18: 80,969,840 E1127V probably benign Het
Sertad3 A G 7: 27,476,695 N185D probably damaging Het
Sox1 A G 8: 12,396,719 Y120C probably damaging Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Spg20 G T 3: 55,117,736 V251L probably damaging Het
Stard9 A G 2: 120,704,155 E3631G probably benign Het
Syde2 A G 3: 146,015,725 T848A probably benign Het
Tmem11 T C 11: 60,865,328 D12G possibly damaging Het
Trim28 T C 7: 13,028,558 probably benign Het
Tsen2 T A 6: 115,547,987 V49E probably damaging Het
Tspan1 C T 4: 116,167,035 M10I probably benign Het
Uncx A T 5: 139,546,689 T170S probably damaging Het
Usp24 T C 4: 106,379,224 probably benign Het
Vmn1r84 T C 7: 12,361,930 I267V probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAAGGAGATCTATGTGTTTTGTGGACC -3'
(R):5'- GCAAGTTTATACAGGTTAGCCAATGG -3'

Sequencing Primer
(F):5'- GTGGACCTTTACAATTTGAAACTCAC -3'
(R):5'- GGATCAAGGTGTAAGCTCC -3'
Posted On2015-04-30