Incidental Mutation 'R4022:Olfr181'
ID313322
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission 040956-MU
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4022 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58926120 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 150 (I150M)
Ref Sequence ENSEMBL: ENSMUSP00000145877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075361
AA Change: I150M

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: I150M

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
Predicted Effect possibly damaging
Transcript: ENSMUST00000205742
AA Change: I150M

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205986
AA Change: I150M

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214942
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T A 2: 26,843,800 Y131F probably damaging Het
Adcy4 C T 14: 55,775,178 probably null Het
Ago3 T A 4: 126,368,593 N388I probably benign Het
Arfgef2 G T 2: 166,873,945 V1385L probably benign Het
Camk2a A T 18: 60,963,928 K28* probably null Het
Ccdc180 T A 4: 45,904,560 Y385* probably null Het
Cd209g A T 8: 4,135,955 Q46L possibly damaging Het
Cdh22 T C 2: 165,157,253 T220A probably benign Het
Cltc A T 11: 86,720,348 C562S probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
D17Wsu92e T C 17: 27,786,262 E107G probably damaging Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dhx30 T C 9: 110,084,397 D1223G possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Erbb2 T G 11: 98,435,297 C966W probably benign Het
Exoc1 C T 5: 76,549,570 T405I possibly damaging Het
Fbxo28 T C 1: 182,329,910 N108S possibly damaging Het
Fhdc1 T C 3: 84,445,102 E157G probably benign Het
Gstcd C T 3: 133,082,068 V290M probably damaging Het
Hps3 A G 3: 20,035,261 V2A possibly damaging Het
Itsn2 G A 12: 4,624,927 R23H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lax1 C T 1: 133,683,036 G105S probably benign Het
Lin7c G T 2: 109,896,445 probably null Het
Lrrn2 T C 1: 132,939,114 V639A probably benign Het
Luzp1 T C 4: 136,542,193 S576P probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mast4 G T 13: 102,853,869 A48E probably damaging Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Megf8 T C 7: 25,337,775 V700A probably damaging Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Myh2 G T 11: 67,179,404 E421* probably null Het
Olfr102 T A 17: 37,314,274 I37L probably benign Het
Pecam1 T C 11: 106,655,160 N693D probably benign Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prune2 A G 19: 17,000,020 T40A probably damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Reln T C 5: 22,227,630 Q124R probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sall3 T A 18: 80,969,840 E1127V probably benign Het
Sertad3 A G 7: 27,476,695 N185D probably damaging Het
Sox1 A G 8: 12,396,719 Y120C probably damaging Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Spg20 G T 3: 55,117,736 V251L probably damaging Het
Stard9 A G 2: 120,704,155 E3631G probably benign Het
Syde2 A G 3: 146,015,725 T848A probably benign Het
Tmem11 T C 11: 60,865,328 D12G possibly damaging Het
Trim28 T C 7: 13,028,558 probably benign Het
Tsen2 T A 6: 115,547,987 V49E probably damaging Het
Tspan1 C T 4: 116,167,035 M10I probably benign Het
Uncx A T 5: 139,546,689 T170S probably damaging Het
Usp24 T C 4: 106,379,224 probably benign Het
Vmn1r84 T C 7: 12,361,930 I267V probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCTGTAAGAGACCAAG -3'
(R):5'- CTGTGGACAGGAGGATTTCTC -3'

Sequencing Primer
(F):5'- TGGTAATGGTAAAGACTTGAATTGGC -3'
(R):5'- CTCTCTATGAGTGCATGGTACAG -3'
Posted On2015-04-30