Mutagenetix > Incidental Mutation

Incidental Mutation 'R4022:Prune2'

313327

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

040956-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4022 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17000020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 40 (T40A)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: T40A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: T40A

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224145

Meta Mutation Damage Score

0.1094

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abo	T	A	2: 26,843,800	Y131F	probably damaging	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Ago3	T	A	4: 126,368,593	N388I	probably benign	Het
Arfgef2	G	T	2: 166,873,945	V1385L	probably benign	Het
Camk2a	A	T	18: 60,963,928	K28*	probably null	Het
Ccdc180	T	A	4: 45,904,560	Y385*	probably null	Het
Cd209g	A	T	8: 4,135,955	Q46L	possibly damaging	Het
Cdh22	T	C	2: 165,157,253	T220A	probably benign	Het
Cltc	A	T	11: 86,720,348	C562S	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Cyp2d34	A	G	15: 82,618,608	V139A	probably benign	Het
D17Wsu92e	T	C	17: 27,786,262	E107G	probably damaging	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dhx30	T	C	9: 110,084,397	D1223G	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Erbb2	T	G	11: 98,435,297	C966W	probably benign	Het
Exoc1	C	T	5: 76,549,570	T405I	possibly damaging	Het
Fbxo28	T	C	1: 182,329,910	N108S	possibly damaging	Het
Fhdc1	T	C	3: 84,445,102	E157G	probably benign	Het
Gstcd	C	T	3: 133,082,068	V290M	probably damaging	Het
Hps3	A	G	3: 20,035,261	V2A	possibly damaging	Het
Itsn2	G	A	12: 4,624,927	R23H	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lax1	C	T	1: 133,683,036	G105S	probably benign	Het
Lin7c	G	T	2: 109,896,445		probably null	Het
Lrrn2	T	C	1: 132,939,114	V639A	probably benign	Het
Luzp1	T	C	4: 136,542,193	S576P	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mast4	G	T	13: 102,853,869	A48E	probably damaging	Het
Mat2a	G	A	6: 72,436,244	R168C	probably damaging	Het
Megf8	T	C	7: 25,337,775	V700A	probably damaging	Het
Mroh2a	G	C	1: 88,246,042	A871P	probably damaging	Het
Myh2	G	T	11: 67,179,404	E421*	probably null	Het
Olfr102	T	A	17: 37,314,274	I37L	probably benign	Het
Olfr181	T	C	16: 58,926,120	I150M	possibly damaging	Het
Pecam1	T	C	11: 106,655,160	N693D	probably benign	Het
Ppip5k1	C	T	2: 121,337,627	R715H	probably damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Reln	T	C	5: 22,227,630	Q124R	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Sall3	T	A	18: 80,969,840	E1127V	probably benign	Het
Sertad3	A	G	7: 27,476,695	N185D	probably damaging	Het
Sox1	A	G	8: 12,396,719	Y120C	probably damaging	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Spg20	G	T	3: 55,117,736	V251L	probably damaging	Het
Stard9	A	G	2: 120,704,155	E3631G	probably benign	Het
Syde2	A	G	3: 146,015,725	T848A	probably benign	Het
Tmem11	T	C	11: 60,865,328	D12G	possibly damaging	Het
Trim28	T	C	7: 13,028,558		probably benign	Het
Tsen2	T	A	6: 115,547,987	V49E	probably damaging	Het
Tspan1	C	T	4: 116,167,035	M10I	probably benign	Het
Uncx	A	T	5: 139,546,689	T170S	probably damaging	Het
Usp24	T	C	4: 106,379,224		probably benign	Het
Vmn1r84	T	C	7: 12,361,930	I267V	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTAGGCTATTTTCCTCTTGAAG -3'
(R):5'- GCAGGTGCTATTCAATAAATGCTTG -3'

Sequencing Primer
(F):5'- TCATTGTGTGTGAGAATAGACAAGC -3'
(R):5'- GGAAAACTAAGTTAGTGGCTTC -3'

Posted On

2015-04-30