Incidental Mutation 'R4023:Fezf2'
ID313363
Institutional Source Beutler Lab
Gene Symbol Fezf2
Ensembl Gene ENSMUSG00000021743
Gene NameFez family zinc finger 2
SynonymsFezl, Zfp312, forebrain embryonic zinc finger, Fez
MMRRC Submission 040957-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R4023 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location12342094-12348189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12343986 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 302 (C302S)
Ref Sequence ENSEMBL: ENSMUSP00000153090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022262] [ENSMUST00000224023] [ENSMUST00000224714]
Predicted Effect probably damaging
Transcript: ENSMUST00000022262
AA Change: C302S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022262
Gene: ENSMUSG00000021743
AA Change: C302S

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
ZnF_C2H2 272 294 1.58e-3 SMART
ZnF_C2H2 300 322 3.39e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 2.57e-3 SMART
ZnF_C2H2 384 406 1.45e-2 SMART
ZnF_C2H2 412 435 1.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224023
AA Change: C302S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000224714
AA Change: C302S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.9643 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show hyperactivity, altered feeding behavior leading to delayed growth and premature death, and impaired formation of subplate neurons and thalamocortical projections. Homozygotes for another allele lack a corpus callosum and show severe subcortical projection defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Acad8 T C 9: 26,979,185 I276V probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Akap9 C T 5: 3,992,077 T1370I possibly damaging Het
Akna C G 4: 63,374,390 G1094A probably benign Het
Catsperb C A 12: 101,602,683 Y871* probably null Het
Ccdc105 T C 10: 78,752,893 T28A probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Depdc1a G A 3: 159,516,149 probably null Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Flnc T C 6: 29,451,635 I1591T possibly damaging Het
Kidins220 A G 12: 25,057,144 probably null Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Olfr1102 A T 2: 87,002,922 K318* probably null Het
Olfr895 G A 9: 38,269,461 C308Y possibly damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Rif1 T A 2: 52,121,087 Y2389N probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Siglecf T A 7: 43,355,571 S408R possibly damaging Het
Stat5a T A 11: 100,874,926 C279* probably null Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp46 A G 5: 74,032,475 Y47H probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Fezf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Fezf2 APN 14 12342498 makesense probably null
IGL02008:Fezf2 APN 14 12343705 missense probably benign 0.01
IGL02238:Fezf2 APN 14 12344494 missense probably damaging 0.98
IGL02428:Fezf2 APN 14 12344494 missense probably damaging 0.98
IGL02588:Fezf2 APN 14 12343687 missense probably damaging 1.00
K3955:Fezf2 UTSW 14 12345097 missense probably damaging 1.00
R0266:Fezf2 UTSW 14 12342607 missense probably damaging 1.00
R0281:Fezf2 UTSW 14 12343977 missense probably damaging 1.00
R0849:Fezf2 UTSW 14 12342607 missense probably damaging 1.00
R1061:Fezf2 UTSW 14 12342713 missense probably damaging 1.00
R1107:Fezf2 UTSW 14 12342624 missense probably damaging 1.00
R1326:Fezf2 UTSW 14 12342644 missense probably benign 0.12
R1914:Fezf2 UTSW 14 12343988 missense probably damaging 1.00
R1955:Fezf2 UTSW 14 12342644 missense probably benign 0.12
R1980:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1981:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1982:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1988:Fezf2 UTSW 14 12344350 missense probably damaging 0.98
R4025:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R4026:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R5373:Fezf2 UTSW 14 12344803 missense possibly damaging 0.67
R6982:Fezf2 UTSW 14 12343645 missense probably damaging 1.00
R7650:Fezf2 UTSW 14 12342653 missense probably damaging 0.97
R7677:Fezf2 UTSW 14 12344941 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCCGCACTGGTTACACTTATG -3'
(R):5'- ACTTGCTGGCTTCAGATGG -3'

Sequencing Primer
(F):5'- TTTCCTGCGAAGAGGGGC -3'
(R):5'- CTGGCTTCAGATGGGATGG -3'
Posted On2015-04-30