Incidental Mutation 'R4023:1110038F14Rik'
List |< first << previous [record 2 of 1113] next >> last >|
ID313366
Institutional Source Beutler Lab
Gene Symbol 1110038F14Rik
Ensembl Gene ENSMUSG00000063236
Gene NameRIKEN cDNA 1110038F14 gene
Synonyms
MMRRC Submission 040957-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4023 (G1)
Quality Score153
Status Not validated
Chromosome15
Chromosomal Location76948506-76950979 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CGGG to CGGGGGG at 76949663 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071792] [ENSMUST00000229229] [ENSMUST00000230274]
Predicted Effect probably benign
Transcript: ENSMUST00000071792
SMART Domains Protein: ENSMUSP00000071698
Gene: ENSMUSG00000063236

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 21 39 N/A INTRINSIC
Pfam:DUF4615 102 221 4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229229
Predicted Effect probably benign
Transcript: ENSMUST00000230274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231058
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 T C 9: 26,979,185 I276V probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Akap9 C T 5: 3,992,077 T1370I possibly damaging Het
Akna C G 4: 63,374,390 G1094A probably benign Het
Catsperb C A 12: 101,602,683 Y871* probably null Het
Ccdc105 T C 10: 78,752,893 T28A probably benign Het
Clcn4 T G 7: 7,290,428 Y503S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Depdc1a G A 3: 159,516,149 probably benign Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Flnc T C 6: 29,451,635 I1591T possibly damaging Het
Kidins220 A G 12: 25,057,144 D1532G possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Olfr1102 A T 2: 87,002,922 K318* probably null Het
Olfr895 G A 9: 38,269,461 C308Y possibly damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Rif1 T A 2: 52,121,087 Y2389N probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Siglecf T A 7: 43,355,571 S408R possibly damaging Het
Stat5a T A 11: 100,874,926 C279* probably null Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp46 A G 5: 74,032,475 Y47H probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in 1110038F14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01063:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01065:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01066:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01067:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01069:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01070:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01128:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01131:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01132:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01133:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01134:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01135:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01154:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL01155:1110038F14Rik APN 15 76950275 missense probably damaging 1.00
IGL02472:1110038F14Rik APN 15 76950378 missense probably damaging 0.98
ANU05:1110038F14Rik UTSW 15 76950275 missense probably damaging 1.00
R1845:1110038F14Rik UTSW 15 76949663 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACGGTGACAGTTCTGTGGTC -3'
(R):5'- CCTCTGTCCCCTAAGAGAGAATAC -3'

Sequencing Primer
(F):5'- TGGAATTCAGAGATCCGCCTG -3'
(R):5'- AGAATACTTTCTCCCCACTTACATC -3'
Posted OnApr 30, 2015