Incidental Mutation 'R4024:Olfr432'
ID313372
Institutional Source Beutler Lab
Gene Symbol Olfr432
Ensembl Gene ENSMUSG00000047048
Gene Nameolfactory receptor 432
SynonymsMOR123-2, GA_x6K02T2P20D-21124681-21123743
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174049205-174054752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 174051117 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 248 (T248I)
Ref Sequence ENSEMBL: ENSMUSP00000150596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062665] [ENSMUST00000213211] [ENSMUST00000213381]
Predicted Effect probably benign
Transcript: ENSMUST00000062665
AA Change: T248I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060341
Gene: ENSMUSG00000047048
AA Change: T248I

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.7e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 307 1.2e-7 PFAM
Pfam:7tm_1 41 289 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192435
Predicted Effect probably benign
Transcript: ENSMUST00000213211
AA Change: T248I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000213381
AA Change: T248I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Olfr432
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Olfr432 APN 1 174050685 missense probably damaging 1.00
IGL03002:Olfr432 APN 1 174050625 missense probably benign 0.03
R0020:Olfr432 UTSW 1 174050847 missense probably damaging 0.99
R0386:Olfr432 UTSW 1 174050399 missense probably benign 0.00
R1735:Olfr432 UTSW 1 174050799 missense probably benign
R1932:Olfr432 UTSW 1 174050678 missense probably damaging 1.00
R2363:Olfr432 UTSW 1 174051248 missense probably damaging 1.00
R3930:Olfr432 UTSW 1 174050510 missense probably damaging 1.00
R4777:Olfr432 UTSW 1 174050678 missense probably damaging 1.00
R4946:Olfr432 UTSW 1 174050834 missense possibly damaging 0.95
R5250:Olfr432 UTSW 1 174051272 missense probably benign
R5646:Olfr432 UTSW 1 174051287 nonsense probably null
R6178:Olfr432 UTSW 1 174050967 missense probably benign 0.00
R6634:Olfr432 UTSW 1 174050969 missense probably benign 0.11
R7578:Olfr432 UTSW 1 174050700 missense possibly damaging 0.71
R7653:Olfr432 UTSW 1 174050922 missense probably benign 0.36
R8110:Olfr432 UTSW 1 174050525 missense probably benign 0.01
RF014:Olfr432 UTSW 1 174050987 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTTTGTGACCTGGCACCAG -3'
(R):5'- CAGCATTAATCCTCTGTGTGACC -3'

Sequencing Primer
(F):5'- ACCAGTGATGCAGTTGGC -3'
(R):5'- TGTGTGACCCTCTTAAAAGCC -3'
Posted On2015-04-30