Incidental Mutation 'R4024:Lrriq4'
ID313380
Institutional Source Beutler Lab
Gene Symbol Lrriq4
Ensembl Gene ENSMUSG00000027703
Gene Nameleucine-rich repeats and IQ motif containing 4
Synonyms4930558O21Rik
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30644507-30672431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30650273 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 150 (V150A)
Ref Sequence ENSEMBL: ENSMUSP00000127052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
Predicted Effect probably benign
Transcript: ENSMUST00000029252
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108265
AA Change: V135A

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703
AA Change: V135A

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108267
AA Change: V150A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703
AA Change: V150A

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172350
AA Change: V150A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703
AA Change: V150A

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Meta Mutation Damage Score 0.2292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Lrriq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Lrriq4 APN 3 30650955 splice site probably null
IGL01289:Lrriq4 APN 3 30650393 missense probably damaging 1.00
IGL02130:Lrriq4 APN 3 30650747 missense probably damaging 0.99
IGL02614:Lrriq4 APN 3 30655639 missense probably damaging 1.00
R0329:Lrriq4 UTSW 3 30655724 missense probably benign 0.03
R1340:Lrriq4 UTSW 3 30650323 missense possibly damaging 0.46
R1440:Lrriq4 UTSW 3 30650761 missense probably damaging 1.00
R1446:Lrriq4 UTSW 3 30650578 missense probably benign 0.00
R1597:Lrriq4 UTSW 3 30650888 missense probably damaging 1.00
R1763:Lrriq4 UTSW 3 30650252 missense probably benign 0.19
R1923:Lrriq4 UTSW 3 30659093 missense probably benign 0.13
R4026:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4645:Lrriq4 UTSW 3 30650743 missense probably benign 0.20
R4816:Lrriq4 UTSW 3 30660047 missense possibly damaging 0.73
R5049:Lrriq4 UTSW 3 30650937 missense probably damaging 0.97
R5105:Lrriq4 UTSW 3 30650483 missense probably damaging 1.00
R5298:Lrriq4 UTSW 3 30645332 start codon destroyed probably null
R5487:Lrriq4 UTSW 3 30659995 missense probably benign 0.16
R6147:Lrriq4 UTSW 3 30659079 missense probably damaging 1.00
R6421:Lrriq4 UTSW 3 30650402 missense probably damaging 1.00
R6452:Lrriq4 UTSW 3 30655733 missense probably damaging 1.00
R6624:Lrriq4 UTSW 3 30650780 missense probably benign 0.01
R7032:Lrriq4 UTSW 3 30655701 nonsense probably null
R8111:Lrriq4 UTSW 3 30655781 missense possibly damaging 0.87
Z1177:Lrriq4 UTSW 3 30649996 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCATCCCGTCAGAGATTTTGG -3'
(R):5'- CAGGTAGATCTCCCTGAGCTTG -3'

Sequencing Primer
(F):5'- CCCGTCAGAGATTTTGGCATTAAAAG -3'
(R):5'- AGATCTCCCTGAGCTTGGTTTG -3'
Posted On2015-04-30