Incidental Mutation 'R4024:Vmn2r6'
ID313381
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R4024 (G1)
Quality Score188
Status Validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64538250 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 685 (S685T)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: S596T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: S596T

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176481
AA Change: S685T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: S685T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTGTGCATACACCAATCTCCC -3'
(R):5'- TTGCTTATGAGGAGGCCCTG -3'

Sequencing Primer
(F):5'- TCTCCCCTACAACACAGATCAG -3'
(R):5'- AGGAGGCCCTGGGGTTC -3'
Posted On2015-04-30