Incidental Mutation 'R4024:Olfr487'
ID313396
Institutional Source Beutler Lab
Gene Symbol Olfr487
Ensembl Gene ENSMUSG00000095929
Gene Nameolfactory receptor 487
SynonymsMOR204-31P, MOR204-29P, GA_x6K02T2PBJ9-10541702-10540758, Olfr1538-ps1, MOR204-31P
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108208868-108214636 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 108211742 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 262 (Y262*)
Ref Sequence ENSEMBL: ENSMUSP00000149407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081996] [ENSMUST00000216489]
Predicted Effect probably null
Transcript: ENSMUST00000081996
AA Change: Y262*
SMART Domains Protein: ENSMUSP00000080657
Gene: ENSMUSG00000095929
AA Change: Y262*

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 6.1e-50 PFAM
Pfam:7tm_1 44 293 1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216489
AA Change: Y262*
Meta Mutation Damage Score 0.9658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Olfr487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr487 APN 7 108211726 missense probably benign 0.06
IGL03133:Olfr487 APN 7 108212387 missense possibly damaging 0.94
IGL03326:Olfr487 APN 7 108211630 missense probably benign 0.03
R0141:Olfr487 UTSW 7 108212003 missense possibly damaging 0.59
R0344:Olfr487 UTSW 7 108211742 nonsense probably null
R0595:Olfr487 UTSW 7 108211661 missense probably damaging 1.00
R1427:Olfr487 UTSW 7 108212094 missense probably benign 0.07
R2023:Olfr487 UTSW 7 108211842 missense probably damaging 1.00
R2065:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R2068:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R3410:Olfr487 UTSW 7 108212283 missense possibly damaging 0.95
R4619:Olfr487 UTSW 7 108212094 missense possibly damaging 0.78
R4738:Olfr487 UTSW 7 108211994 missense probably damaging 0.99
R5004:Olfr487 UTSW 7 108212116 nonsense probably null
R5684:Olfr487 UTSW 7 108212072 nonsense probably null
R6782:Olfr487 UTSW 7 108212463 missense probably benign 0.03
R6889:Olfr487 UTSW 7 108211918 missense probably benign 0.00
R7010:Olfr487 UTSW 7 108212142 missense probably damaging 0.98
R7076:Olfr487 UTSW 7 108211998 missense probably damaging 1.00
R8162:Olfr487 UTSW 7 108211788 missense probably damaging 1.00
R8190:Olfr487 UTSW 7 108211807 missense possibly damaging 0.80
Z1177:Olfr487 UTSW 7 108211969 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTTACCAACAACTGACTGCTC -3'
(R):5'- ACTCTCCTGTTCTGATGTGAGTATC -3'

Sequencing Primer
(F):5'- ACAACTGACTGCTCTATAACAATG -3'
(R):5'- AATTGTTATCTCATTTTCTGCAGGC -3'
Posted On2015-04-30