Mutagenetix > Incidental Mutations

Incidental Mutation 'R4024:Eef2k'

313397

Institutional Source

Beutler Lab

Gene Symbol

Eef2k

Ensembl Gene

ENSMUSG00000035064

Gene Name

eukaryotic elongation factor-2 kinase

Synonyms

eEF-2K

MMRRC Submission

041612-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R4024 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120842831-120907450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120858598 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 60 (Y60C)

Ref Sequence

ENSEMBL: ENSMUSP00000102096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000143279] [ENSMUST00000143322]

Predicted Effect

probably benign
Transcript: ENSMUST00000047875
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: Y60C

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	525	562	7.2e-5	PFAM
Pfam:Sel1	564	608	2.9e-3	PFAM
Pfam:Sel1	609	645	1.3e-1	PFAM
Pfam:Sel1	665	699	1.2e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106487
AA Change: Y60C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064
AA Change: Y60C

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	1e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
Pfam:Sel1	432	472	1.8e-3	PFAM
Pfam:Sel1	474	518	7.2e-3	PFAM
Pfam:Sel1	519	555	8e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106488
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: Y60C

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	522	562	1.1e-3	PFAM
Pfam:Sel1	564	608	3.9e-3	PFAM
Pfam:Sel1	609	645	4.8e-2	PFAM
Pfam:Sel1	664	699	4.6e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106489
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: Y60C

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	522	562	1.1e-3	PFAM
Pfam:Sel1	564	608	3.9e-3	PFAM
Pfam:Sel1	609	645	4.8e-2	PFAM
Pfam:Sel1	664	699	4.6e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143279

Predicted Effect

probably benign
Transcript: ENSMUST00000143322
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000115486
Gene: ENSMUSG00000035064
AA Change: Y60C

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	6e-15	BLAST
Blast:Alpha_kinase	120	160	1e-21	BLAST
SCOP:d1ia9a_	129	160	3e-7	SMART

Meta Mutation Damage Score

0.0641

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,168,477	Y842H	probably damaging	Het
Adamts9	A	G	6: 92,872,784		probably benign	Het
Adgrg7	A	T	16: 56,730,298	Y684N	probably damaging	Het
Aoc1	A	T	6: 48,908,269	N646I	probably damaging	Het
Armc2	A	G	10: 41,993,058	S37P	probably benign	Het
Bhmt2	G	A	13: 93,663,331		probably benign	Het
Bpifb1	A	T	2: 154,213,046	D286V	probably damaging	Het
Cadps	T	A	14: 12,705,539	E285D	probably damaging	Het
Cap2	C	T	13: 46,637,841		probably benign	Het
Clcn4	T	G	7: 7,290,428	Y443S	probably damaging	Het
Clcn6	T	A	4: 148,014,283	T463S	possibly damaging	Het
Cmip	A	G	8: 117,447,416	I412V	possibly damaging	Het
Cndp1	T	C	18: 84,628,813	D250G	probably damaging	Het
Colec10	A	G	15: 54,462,551	D259G	probably damaging	Het
Ctnna2	A	T	6: 77,636,844	D254E	possibly damaging	Het
Dlec1	T	C	9: 119,137,340	Y1126H	probably damaging	Het
Dzank1	T	C	2: 144,482,227	S565G	probably benign	Het
Fam208b	T	C	13: 3,584,554	D751G	probably damaging	Het
Fbxl4	T	C	4: 22,377,074	V170A	possibly damaging	Het
Foxk2	T	A	11: 121,285,613	I195N	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gpr6	G	A	10: 41,071,268	T106M	probably damaging	Het
Grk3	T	A	5: 112,914,984	N666Y	possibly damaging	Het
Hnmt	T	C	2: 24,003,765	D239G	probably benign	Het
Igf2	A	G	7: 142,654,307	V111A	probably benign	Het
Lrriq3	G	A	3: 155,188,302	E547K	probably benign	Het
Lrriq4	T	C	3: 30,650,273	V150A	possibly damaging	Het
Mroh8	A	G	2: 157,256,352	V292A	probably benign	Het
Myo1e	A	G	9: 70,324,875	I229V	probably benign	Het
Nisch	A	G	14: 31,176,819		probably benign	Het
Nkx2-2	T	C	2: 147,184,234	T195A	probably benign	Het
Olfr1132	T	A	2: 87,635,155	L197F	probably damaging	Het
Olfr328	G	A	11: 58,551,396	T281I	possibly damaging	Het
Olfr432	C	T	1: 174,051,117	T248I	probably benign	Het
Olfr487	A	T	7: 108,211,742	Y262*	probably null	Het
Plekhn1	A	G	4: 156,224,750	V233A	probably damaging	Het
Ppp3r1	T	C	11: 17,194,786	V133A	probably damaging	Het
Sash1	T	C	10: 8,729,917	D903G	probably benign	Het
Scn8a	A	G	15: 101,039,793	D1681G	probably damaging	Het
Slk	A	G	19: 47,622,370		probably null	Het
Tlr11	C	T	14: 50,362,846	T763I	probably benign	Het
Ttbk2	T	C	2: 120,760,255	T308A	possibly damaging	Het
Tyk2	G	A	9: 21,115,919	L552F	probably damaging	Het
Ubp1	A	G	9: 113,944,883	D50G	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ulk4	A	T	9: 121,044,849	I1172N	possibly damaging	Het
Usf3	T	A	16: 44,216,165	V336E	possibly damaging	Het
Vangl2	T	C	1: 172,008,041	S355G	probably benign	Het
Vmn1r216	A	G	13: 23,099,891	D248G	probably damaging	Het
Vmn1r34	T	A	6: 66,637,704	M17L	probably benign	Het
Vmn2r120	T	A	17: 57,536,718	D42V	possibly damaging	Het
Vmn2r6	A	T	3: 64,538,250	S685T	possibly damaging	Het
Vsig10l	T	C	7: 43,468,086	V701A	probably benign	Het
Wdfy3	A	G	5: 101,924,095		probably benign	Het
Zfp808	T	A	13: 62,171,730	C258S	possibly damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Eef2k

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01323:Eef2k	APN	7	120884815	unclassified	probably benign
IGL01481:Eef2k	APN	7	120895218	missense	probably benign	0.23
IGL01935:Eef2k	APN	7	120885831	missense	probably damaging	1.00
IGL03109:Eef2k	APN	7	120891726	missense	probably damaging	1.00
R0458:Eef2k	UTSW	7	120903290	missense	probably damaging	0.99
R1639:Eef2k	UTSW	7	120885828	missense	probably damaging	1.00
R1986:Eef2k	UTSW	7	120873346	missense	possibly damaging	0.92
R3419:Eef2k	UTSW	7	120885870	missense	probably damaging	0.99
R3610:Eef2k	UTSW	7	120889235	missense	probably benign
R3707:Eef2k	UTSW	7	120884712	missense	probably damaging	1.00
R3856:Eef2k	UTSW	7	120899371	nonsense	probably null
R4535:Eef2k	UTSW	7	120858599	nonsense	probably null
R4885:Eef2k	UTSW	7	120891932	missense	probably benign
R5137:Eef2k	UTSW	7	120885422	missense	probably damaging	0.99
R5137:Eef2k	UTSW	7	120885423	missense	probably damaging	1.00
R5501:Eef2k	UTSW	7	120889248	missense	probably benign	0.00
R5610:Eef2k	UTSW	7	120886782	missense	probably benign	0.00
R5633:Eef2k	UTSW	7	120873290	intron	probably benign
R7002:Eef2k	UTSW	7	120891932	missense	probably benign
R7166:Eef2k	UTSW	7	120884772	missense	probably damaging	1.00
R7254:Eef2k	UTSW	7	120889265	missense	probably benign	0.11
R7466:Eef2k	UTSW	7	120903484	splice site	probably null
R7486:Eef2k	UTSW	7	120858570	missense	probably benign
R7538:Eef2k	UTSW	7	120891992	missense	probably benign	0.29
R7593:Eef2k	UTSW	7	120889268	critical splice donor site	probably null
R7675:Eef2k	UTSW	7	120858504	missense	probably benign
R7815:Eef2k	UTSW	7	120858570	missense	probably benign
R7898:Eef2k	UTSW	7	120895218	missense	probably damaging	1.00
R8182:Eef2k	UTSW	7	120873403	missense	probably damaging	1.00
R8288:Eef2k	UTSW	7	120903381	missense	probably damaging	1.00
R8495:Eef2k	UTSW	7	120887880	missense	probably benign	0.00
R8807:Eef2k	UTSW	7	120891707	missense	possibly damaging	0.69
Z1177:Eef2k	UTSW	7	120858453	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGACCTCATCTTCTGCCTGG -3'
(R):5'- GCTCTGTGGCAAGAAAACATATC -3'

Sequencing Primer
(F):5'- ATCTTCTGCCTGGAAGGTGTTGAC -3'
(R):5'- GTCACCTCCTAGATTAATGGGAC -3'

Posted On

2015-04-30