Incidental Mutation 'R4024:Eef2k'
ID313397
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Nameeukaryotic elongation factor-2 kinase
SynonymseEF-2K
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120842831-120907450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120858598 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000102096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000143279] [ENSMUST00000143322]
Predicted Effect probably benign
Transcript: ENSMUST00000047875
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: Y60C

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106487
AA Change: Y60C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064
AA Change: Y60C

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 1e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
Pfam:Sel1 432 472 1.8e-3 PFAM
Pfam:Sel1 474 518 7.2e-3 PFAM
Pfam:Sel1 519 555 8e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: Y60C

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: Y60C

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143279
Predicted Effect probably benign
Transcript: ENSMUST00000143322
AA Change: Y60C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115486
Gene: ENSMUSG00000035064
AA Change: Y60C

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 6e-15 BLAST
Blast:Alpha_kinase 120 160 1e-21 BLAST
SCOP:d1ia9a_ 129 160 3e-7 SMART
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCTCATCTTCTGCCTGG -3'
(R):5'- GCTCTGTGGCAAGAAAACATATC -3'

Sequencing Primer
(F):5'- ATCTTCTGCCTGGAAGGTGTTGAC -3'
(R):5'- GTCACCTCCTAGATTAATGGGAC -3'
Posted On2015-04-30