Incidental Mutation 'R4024:Igf2'
ID313398
Institutional Source Beutler Lab
Gene Symbol Igf2
Ensembl Gene ENSMUSG00000048583
Gene Nameinsulin-like growth factor 2
SynonymsM6pr, Mpr, Igf-2, Igf-II, Peg2
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142650766-142666816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142654307 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000114076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000033] [ENSMUST00000097936] [ENSMUST00000105935] [ENSMUST00000105936] [ENSMUST00000121128] [ENSMUST00000145896] [ENSMUST00000178921] [ENSMUST00000228850]
Predicted Effect probably benign
Transcript: ENSMUST00000000033
AA Change: V100A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000000033
Gene: ENSMUSG00000048583
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093631
Predicted Effect probably benign
Transcript: ENSMUST00000097936
AA Change: V100A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095549
Gene: ENSMUSG00000048583
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105935
AA Change: V100A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101555
Gene: ENSMUSG00000048583
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105936
AA Change: V100A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101556
Gene: ENSMUSG00000048583
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121128
AA Change: V111A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114076
Gene: ENSMUSG00000048583
AA Change: V111A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IlGF 41 95 2.09e-22 SMART
Pfam:IGF2_C 123 177 6.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143666
Predicted Effect probably benign
Transcript: ENSMUST00000145896
AA Change: V100A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122653
Gene: ENSMUSG00000048583
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163148
Predicted Effect probably benign
Transcript: ENSMUST00000178921
SMART Domains Protein: ENSMUSP00000136786
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
IlGF 67 121 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228850
Meta Mutation Damage Score 0.0573 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mutations that are paternally transmitted result in growth deficiency. Heterozygous mice inheriting a mutant allele from their mother appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Igf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Igf2 APN 7 142654048 missense probably benign 0.09
R2012:Igf2 UTSW 7 142654399 missense probably damaging 1.00
R4275:Igf2 UTSW 7 142655786 missense probably benign 0.00
R5247:Igf2 UTSW 7 142653931 missense possibly damaging 0.90
R5825:Igf2 UTSW 7 142653855 missense probably damaging 0.97
R6185:Igf2 UTSW 7 142658381 missense possibly damaging 0.95
R7286:Igf2 UTSW 7 142655818 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGGGTATCATGTTAGCCTGAGC -3'
(R):5'- ACTAACTGAAGTTGTCTGTCCTGTG -3'

Sequencing Primer
(F):5'- TAGGTGTCGCATATCCCCAG -3'
(R):5'- AAGTTGTCTGTCCTGTGGAACTTCC -3'
Posted On2015-04-30