Incidental Mutation 'R4024:Cmip'
ID313399
Institutional Source Beutler Lab
Gene Symbol Cmip
Ensembl Gene ENSMUSG00000034390
Gene Namec-Maf inducing protein
Synonyms
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117257064-117459430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117447416 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 412 (I412V)
Ref Sequence ENSEMBL: ENSMUSP00000092795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095172] [ENSMUST00000166750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095172
AA Change: I412V

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092795
Gene: ENSMUSG00000034390
AA Change: I412V

DomainStartEndE-ValueType
Blast:PH 13 70 5e-33 BLAST
low complexity region 71 79 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
SCOP:d1a9na_ 564 681 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166750
AA Change: I500V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130264
Gene: ENSMUSG00000034390
AA Change: I500V

DomainStartEndE-ValueType
PH 54 163 2.71e-1 SMART
low complexity region 394 407 N/A INTRINSIC
SCOP:d1a9na_ 652 769 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212884
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Cmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Cmip APN 8 117445328 missense probably benign 0.29
IGL02126:Cmip APN 8 117449031 missense probably damaging 0.99
IGL02205:Cmip APN 8 117454975 missense probably damaging 1.00
IGL02352:Cmip APN 8 117411255 splice site probably benign
IGL02359:Cmip APN 8 117411255 splice site probably benign
IGL02558:Cmip APN 8 117449088 missense probably damaging 0.99
R0070:Cmip UTSW 8 117426554 missense probably damaging 0.99
R0335:Cmip UTSW 8 117445366 missense probably damaging 0.99
R1225:Cmip UTSW 8 117445371 missense probably damaging 0.98
R1561:Cmip UTSW 8 117453850 missense probably benign 0.41
R2508:Cmip UTSW 8 117436693 missense probably benign
R2885:Cmip UTSW 8 117384965 missense probably benign 0.01
R3415:Cmip UTSW 8 117349377 critical splice donor site probably null
R4168:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4169:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4632:Cmip UTSW 8 117447411 missense possibly damaging 0.88
R4706:Cmip UTSW 8 117377154 missense probably damaging 0.99
R4924:Cmip UTSW 8 117257255 missense probably benign 0.00
R5380:Cmip UTSW 8 117422890 missense probably damaging 0.99
R5927:Cmip UTSW 8 117257309 missense possibly damaging 0.85
R6212:Cmip UTSW 8 117377156 missense probably damaging 1.00
R6310:Cmip UTSW 8 117429810 missense possibly damaging 0.63
R6747:Cmip UTSW 8 117436879 missense probably benign 0.02
R6881:Cmip UTSW 8 117436595 missense possibly damaging 0.77
R6968:Cmip UTSW 8 117377156 missense probably damaging 1.00
R7003:Cmip UTSW 8 117384988 missense probably benign 0.13
R7400:Cmip UTSW 8 117257405 splice site probably null
R7583:Cmip UTSW 8 117454952 missense probably damaging 0.96
R8367:Cmip UTSW 8 117436871 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTGTGAATGCTCCCTGTATCTG -3'
(R):5'- TCTGCAAGGAGACCTAGGAG -3'

Sequencing Primer
(F):5'- GTGAATGCTCCCTGTATCTGATCAC -3'
(R):5'- CAGTGTTTGTTTAGGTCCC -3'
Posted On2015-04-30