Mutagenetix > Incidental Mutation

Incidental Mutation 'R4024:Ulk4'

313406

Institutional Source

Beutler Lab

Gene Symbol

Ulk4

Ensembl Gene

ENSMUSG00000040936

Gene Name

unc-51-like kinase 4

Synonyms

4932415A06Rik

MMRRC Submission

041612-MU

Accession Numbers

Genbank: NM_177589; MGI: 1921622

Essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R4024 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

120955351-121277197 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121044849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1172 (I1172N)

Ref Sequence

ENSEMBL: ENSMUSP00000131342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171061] [ENSMUST00000171923]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170406

Predicted Effect

probably benign
Transcript: ENSMUST00000171061

SMART Domains

Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	4.3e-26	PFAM
Pfam:Pkinase	4	280	2.1e-49	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171923
AA Change: I1172N

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: I1172N

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	153	3.1e-14	PFAM
Pfam:Pkinase	4	280	4.9e-50	PFAM
Pfam:Pkinase_Tyr	165	277	6.1e-10	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1171	N/A	INTRINSIC

Meta Mutation Damage Score

0.2034

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,168,477	Y842H	probably damaging	Het
Adamts9	A	G	6: 92,872,784		probably benign	Het
Adgrg7	A	T	16: 56,730,298	Y684N	probably damaging	Het
Aoc1	A	T	6: 48,908,269	N646I	probably damaging	Het
Armc2	A	G	10: 41,993,058	S37P	probably benign	Het
Bhmt2	G	A	13: 93,663,331		probably benign	Het
Bpifb1	A	T	2: 154,213,046	D286V	probably damaging	Het
Cadps	T	A	14: 12,705,539	E285D	probably damaging	Het
Cap2	C	T	13: 46,637,841		probably benign	Het
Clcn4	T	G	7: 7,290,428	Y443S	probably damaging	Het
Clcn6	T	A	4: 148,014,283	T463S	possibly damaging	Het
Cmip	A	G	8: 117,447,416	I412V	possibly damaging	Het
Cndp1	T	C	18: 84,628,813	D250G	probably damaging	Het
Colec10	A	G	15: 54,462,551	D259G	probably damaging	Het
Ctnna2	A	T	6: 77,636,844	D254E	possibly damaging	Het
Dlec1	T	C	9: 119,137,340	Y1126H	probably damaging	Het
Dzank1	T	C	2: 144,482,227	S565G	probably benign	Het
Eef2k	A	G	7: 120,858,598	Y60C	probably benign	Het
Fam208b	T	C	13: 3,584,554	D751G	probably damaging	Het
Fbxl4	T	C	4: 22,377,074	V170A	possibly damaging	Het
Foxk2	T	A	11: 121,285,613	I195N	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gpr6	G	A	10: 41,071,268	T106M	probably damaging	Het
Grk3	T	A	5: 112,914,984	N666Y	possibly damaging	Het
Hnmt	T	C	2: 24,003,765	D239G	probably benign	Het
Igf2	A	G	7: 142,654,307	V111A	probably benign	Het
Lrriq3	G	A	3: 155,188,302	E547K	probably benign	Het
Lrriq4	T	C	3: 30,650,273	V150A	possibly damaging	Het
Mroh8	A	G	2: 157,256,352	V292A	probably benign	Het
Myo1e	A	G	9: 70,324,875	I229V	probably benign	Het
Nisch	A	G	14: 31,176,819		probably benign	Het
Nkx2-2	T	C	2: 147,184,234	T195A	probably benign	Het
Olfr1132	T	A	2: 87,635,155	L197F	probably damaging	Het
Olfr328	G	A	11: 58,551,396	T281I	possibly damaging	Het
Olfr432	C	T	1: 174,051,117	T248I	probably benign	Het
Olfr487	A	T	7: 108,211,742	Y262*	probably null	Het
Plekhn1	A	G	4: 156,224,750	V233A	probably damaging	Het
Ppp3r1	T	C	11: 17,194,786	V133A	probably damaging	Het
Sash1	T	C	10: 8,729,917	D903G	probably benign	Het
Scn8a	A	G	15: 101,039,793	D1681G	probably damaging	Het
Slk	A	G	19: 47,622,370		probably null	Het
Tlr11	C	T	14: 50,362,846	T763I	probably benign	Het
Ttbk2	T	C	2: 120,760,255	T308A	possibly damaging	Het
Tyk2	G	A	9: 21,115,919	L552F	probably damaging	Het
Ubp1	A	G	9: 113,944,883	D50G	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usf3	T	A	16: 44,216,165	V336E	possibly damaging	Het
Vangl2	T	C	1: 172,008,041	S355G	probably benign	Het
Vmn1r216	A	G	13: 23,099,891	D248G	probably damaging	Het
Vmn1r34	T	A	6: 66,637,704	M17L	probably benign	Het
Vmn2r120	T	A	17: 57,536,718	D42V	possibly damaging	Het
Vmn2r6	A	T	3: 64,538,250	S685T	possibly damaging	Het
Vsig10l	T	C	7: 43,468,086	V701A	probably benign	Het
Wdfy3	A	G	5: 101,924,095		probably benign	Het
Zfp808	T	A	13: 62,171,730	C258S	possibly damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Ulk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01122:Ulk4	APN	9	121168292	missense	possibly damaging	0.48
IGL01345:Ulk4	APN	9	121208162	missense	possibly damaging	0.48
IGL01432:Ulk4	APN	9	121266301	missense	probably damaging	1.00
IGL01807:Ulk4	APN	9	121255185	missense	probably damaging	1.00
IGL02139:Ulk4	APN	9	121141831	splice site	probably null
IGL02266:Ulk4	APN	9	121081700	missense	probably benign	0.10
IGL02511:Ulk4	APN	9	121188354	missense	probably damaging	1.00
IGL02546:Ulk4	APN	9	121152307	nonsense	probably null
IGL02687:Ulk4	APN	9	121192662	missense	possibly damaging	0.89
IGL03220:Ulk4	APN	9	121145336	missense	probably damaging	1.00
3-1:Ulk4	UTSW	9	121255171	missense	probably benign	0.02
R0031:Ulk4	UTSW	9	121272982	missense	probably damaging	1.00
R0433:Ulk4	UTSW	9	121044819	missense	probably benign	0.27
R0513:Ulk4	UTSW	9	121152325	missense	probably benign	0.13
R0524:Ulk4	UTSW	9	121252651	critical splice donor site	probably null
R1268:Ulk4	UTSW	9	121257074	splice site	probably benign
R1439:Ulk4	UTSW	9	121266258	missense	possibly damaging	0.58
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1531:Ulk4	UTSW	9	121044775	missense	probably damaging	0.97
R1595:Ulk4	UTSW	9	121044838	missense	probably damaging	0.96
R1620:Ulk4	UTSW	9	121204805	missense	possibly damaging	0.81
R1835:Ulk4	UTSW	9	121168184	missense	probably null	1.00
R1966:Ulk4	UTSW	9	121257116	missense	probably benign
R2129:Ulk4	UTSW	9	121152182	missense	probably benign	0.03
R2329:Ulk4	UTSW	9	121272887	missense	probably damaging	1.00
R2877:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R2878:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R3734:Ulk4	UTSW	9	121261989	missense	probably benign	0.21
R3769:Ulk4	UTSW	9	121263700	missense	probably benign	0.00
R4005:Ulk4	UTSW	9	121168199	missense	possibly damaging	0.94
R4321:Ulk4	UTSW	9	121073996	missense	probably benign	0.00
R4461:Ulk4	UTSW	9	121156884	missense	possibly damaging	0.83
R4537:Ulk4	UTSW	9	121263638	nonsense	probably null
R4542:Ulk4	UTSW	9	121263638	nonsense	probably null
R4572:Ulk4	UTSW	9	121192764	missense	probably damaging	1.00
R4647:Ulk4	UTSW	9	121141852	missense	probably benign	0.15
R4712:Ulk4	UTSW	9	121244370	missense	probably benign	0.23
R4730:Ulk4	UTSW	9	121263725	missense	probably benign	0.05
R4731:Ulk4	UTSW	9	121263638	nonsense	probably null
R4732:Ulk4	UTSW	9	121263638	nonsense	probably null
R4733:Ulk4	UTSW	9	121263638	nonsense	probably null
R4737:Ulk4	UTSW	9	121073872	nonsense	probably null
R4781:Ulk4	UTSW	9	121103576	missense	probably benign	0.00
R4860:Ulk4	UTSW	9	121250902	missense	possibly damaging	0.68
R4926:Ulk4	UTSW	9	121258732	missense	probably benign	0.00
R4990:Ulk4	UTSW	9	121192786	missense	probably benign	0.01
R6056:Ulk4	UTSW	9	121272955	missense	probably damaging	1.00
R6448:Ulk4	UTSW	9	121103630	missense	probably damaging	0.99
R6546:Ulk4	UTSW	9	121141894	missense	probably damaging	1.00
R6668:Ulk4	UTSW	9	121188342	missense	probably damaging	1.00
R6915:Ulk4	UTSW	9	121258820	missense	probably benign
R6929:Ulk4	UTSW	9	121074015	missense	probably benign	0.02
R7069:Ulk4	UTSW	9	121258810	missense	probably benign	0.01
R7069:Ulk4	UTSW	9	121266517	missense	probably benign	0.25
R7293:Ulk4	UTSW	9	121255124	missense	probably damaging	1.00
R7299:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7301:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7337:Ulk4	UTSW	9	121248927	missense	probably benign	0.44
R7395:Ulk4	UTSW	9	121255112	missense	probably benign
R7423:Ulk4	UTSW	9	121103621	missense	possibly damaging	0.48
R7545:Ulk4	UTSW	9	121141838	missense	probably benign	0.00
R7753:Ulk4	UTSW	9	121266512	critical splice donor site	probably null
R7790:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7791:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7793:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7834:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7836:Ulk4	UTSW	9	121044819	missense	possibly damaging	0.72
R7960:Ulk4	UTSW	9	121272956	missense	probably damaging	1.00
R8087:Ulk4	UTSW	9	121266251	missense	probably damaging	0.99
R8203:Ulk4	UTSW	9	121168208	missense	probably damaging	0.96
R8246:Ulk4	UTSW	9	121156875	makesense	probably null
R8430:Ulk4	UTSW	9	121257078	critical splice donor site	probably null
R8841:Ulk4	UTSW	9	121204738	missense	probably damaging	1.00
R9014:Ulk4	UTSW	9	121188228	missense	probably benign	0.00
R9092:Ulk4	UTSW	9	121073937	missense
R9126:Ulk4	UTSW	9	121261922	missense	probably damaging	0.99
R9176:Ulk4	UTSW	9	121145062	missense	probably benign
R9235:Ulk4	UTSW	9	121152151	missense	probably benign	0.13
R9713:Ulk4	UTSW	9	121044796	nonsense	probably null
X0024:Ulk4	UTSW	9	121192753	missense	probably damaging	1.00
X0066:Ulk4	UTSW	9	121262606	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAATAAGGTCCCTGCCCAG -3'
(R):5'- GGAATTGGTGTGAATAGCCTTC -3'

Sequencing Primer
(F):5'- TGCCCAGTCCTGCTGTG -3'
(R):5'- GCCTTCAGTAAAGCATCGTAGTG -3'

Posted On

2015-04-30