Incidental Mutation 'R4024:Armc2'
ID313409
Institutional Source Beutler Lab
Gene Symbol Armc2
Ensembl Gene ENSMUSG00000071324
Gene Namearmadillo repeat containing 2
Synonyms
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41914990-42018442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41993058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 37 (S37P)
Ref Sequence ENSEMBL: ENSMUSP00000125635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095729] [ENSMUST00000160262] [ENSMUST00000161167] [ENSMUST00000161927]
Predicted Effect probably benign
Transcript: ENSMUST00000095729
AA Change: S211P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093397
Gene: ENSMUSG00000071324
AA Change: S211P

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160262
AA Change: S211P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125412
Gene: ENSMUSG00000071324
AA Change: S211P

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161167
AA Change: S37P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000161927
SMART Domains Protein: ENSMUSP00000124049
Gene: ENSMUSG00000071324

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Armc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Armc2 UTSW 10 41947887 splice site probably benign
R0144:Armc2 UTSW 10 41947887 splice site probably benign
R0427:Armc2 UTSW 10 42000410 missense possibly damaging 0.87
R0540:Armc2 UTSW 10 41922695 missense probably benign 0.11
R0561:Armc2 UTSW 10 41993192 missense probably benign 0.02
R0607:Armc2 UTSW 10 41922695 missense probably benign 0.11
R1099:Armc2 UTSW 10 41917187 missense probably benign 0.39
R1130:Armc2 UTSW 10 42011834 missense possibly damaging 0.85
R2116:Armc2 UTSW 10 41963667 missense probably damaging 0.98
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2873:Armc2 UTSW 10 41966700 critical splice donor site probably null
R3083:Armc2 UTSW 10 41966730 missense probably damaging 1.00
R3771:Armc2 UTSW 10 41922227 missense probably damaging 1.00
R3784:Armc2 UTSW 10 41922194 missense probably benign 0.08
R3880:Armc2 UTSW 10 41963725 missense possibly damaging 0.71
R4155:Armc2 UTSW 10 42011867 missense probably damaging 0.96
R4370:Armc2 UTSW 10 41917200 missense probably benign 0.13
R4378:Armc2 UTSW 10 41993082 missense possibly damaging 0.66
R4896:Armc2 UTSW 10 41923794 missense probably damaging 1.00
R5119:Armc2 UTSW 10 41922148 missense probably damaging 1.00
R5159:Armc2 UTSW 10 42008715 missense probably damaging 0.96
R5517:Armc2 UTSW 10 41963850 missense probably benign 0.29
R5640:Armc2 UTSW 10 42011898 missense possibly damaging 0.87
R5767:Armc2 UTSW 10 42011927 missense probably benign 0.02
R5965:Armc2 UTSW 10 41922572 missense possibly damaging 0.94
R6897:Armc2 UTSW 10 41993229 critical splice acceptor site probably null
R7233:Armc2 UTSW 10 41923804 missense probably damaging 1.00
R7829:Armc2 UTSW 10 41926860 missense probably benign
R7832:Armc2 UTSW 10 41966796 missense probably damaging 1.00
R7999:Armc2 UTSW 10 42011958 missense possibly damaging 0.62
R8029:Armc2 UTSW 10 41927000 missense probably damaging 1.00
R8030:Armc2 UTSW 10 41966742 missense possibly damaging 0.73
R8033:Armc2 UTSW 10 42008684 missense possibly damaging 0.87
R8191:Armc2 UTSW 10 41963751 missense probably benign 0.29
R8304:Armc2 UTSW 10 41947939 missense probably damaging 1.00
R8334:Armc2 UTSW 10 41923765 missense probably damaging 1.00
R8370:Armc2 UTSW 10 41923837 missense possibly damaging 0.96
Z1176:Armc2 UTSW 10 41927044 missense probably damaging 1.00
Z1176:Armc2 UTSW 10 41963656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCTAAGGATGCAACCG -3'
(R):5'- GCAAAGACCGTGGACGAATC -3'

Sequencing Primer
(F):5'- CCTAGCCAACCATAAGGAGAG -3'
(R):5'- CCAGCAAACCCGTTAGCGTG -3'
Posted On2015-04-30