Mutagenetix > Incidental Mutations

Incidental Mutation 'R4024:Actn1'

313413

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

MMRRC Submission

041612-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.364) question?

Stock #

R4024 (G1)

Quality Score

142

Status

Validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80168477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 842 (Y842H)

Ref Sequence

ENSEMBL: ENSMUSP00000021554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

AlphaFold

Q7TPR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000021554
AA Change: Y842H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: Y842H

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167327
AA Change: Y837H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: Y837H

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219382

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219634

Meta Mutation Damage Score

0.7104

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	A	G	6: 92,872,784		probably benign	Het
Adgrg7	A	T	16: 56,730,298	Y684N	probably damaging	Het
Aoc1	A	T	6: 48,908,269	N646I	probably damaging	Het
Armc2	A	G	10: 41,993,058	S37P	probably benign	Het
Bhmt2	G	A	13: 93,663,331		probably benign	Het
Bpifb1	A	T	2: 154,213,046	D286V	probably damaging	Het
Cadps	T	A	14: 12,705,539	E285D	probably damaging	Het
Cap2	C	T	13: 46,637,841		probably benign	Het
Clcn4	T	G	7: 7,290,428	Y443S	probably damaging	Het
Clcn6	T	A	4: 148,014,283	T463S	possibly damaging	Het
Cmip	A	G	8: 117,447,416	I412V	possibly damaging	Het
Cndp1	T	C	18: 84,628,813	D250G	probably damaging	Het
Colec10	A	G	15: 54,462,551	D259G	probably damaging	Het
Ctnna2	A	T	6: 77,636,844	D254E	possibly damaging	Het
Dlec1	T	C	9: 119,137,340	Y1126H	probably damaging	Het
Dzank1	T	C	2: 144,482,227	S565G	probably benign	Het
Eef2k	A	G	7: 120,858,598	Y60C	probably benign	Het
Fam208b	T	C	13: 3,584,554	D751G	probably damaging	Het
Fbxl4	T	C	4: 22,377,074	V170A	possibly damaging	Het
Foxk2	T	A	11: 121,285,613	I195N	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gpr6	G	A	10: 41,071,268	T106M	probably damaging	Het
Grk3	T	A	5: 112,914,984	N666Y	possibly damaging	Het
Hnmt	T	C	2: 24,003,765	D239G	probably benign	Het
Igf2	A	G	7: 142,654,307	V111A	probably benign	Het
Lrriq3	G	A	3: 155,188,302	E547K	probably benign	Het
Lrriq4	T	C	3: 30,650,273	V150A	possibly damaging	Het
Mroh8	A	G	2: 157,256,352	V292A	probably benign	Het
Myo1e	A	G	9: 70,324,875	I229V	probably benign	Het
Nisch	A	G	14: 31,176,819		probably benign	Het
Nkx2-2	T	C	2: 147,184,234	T195A	probably benign	Het
Olfr1132	T	A	2: 87,635,155	L197F	probably damaging	Het
Olfr328	G	A	11: 58,551,396	T281I	possibly damaging	Het
Olfr432	C	T	1: 174,051,117	T248I	probably benign	Het
Olfr487	A	T	7: 108,211,742	Y262*	probably null	Het
Plekhn1	A	G	4: 156,224,750	V233A	probably damaging	Het
Ppp3r1	T	C	11: 17,194,786	V133A	probably damaging	Het
Sash1	T	C	10: 8,729,917	D903G	probably benign	Het
Scn8a	A	G	15: 101,039,793	D1681G	probably damaging	Het
Slk	A	G	19: 47,622,370		probably null	Het
Tlr11	C	T	14: 50,362,846	T763I	probably benign	Het
Ttbk2	T	C	2: 120,760,255	T308A	possibly damaging	Het
Tyk2	G	A	9: 21,115,919	L552F	probably damaging	Het
Ubp1	A	G	9: 113,944,883	D50G	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ulk4	A	T	9: 121,044,849	I1172N	possibly damaging	Het
Usf3	T	A	16: 44,216,165	V336E	possibly damaging	Het
Vangl2	T	C	1: 172,008,041	S355G	probably benign	Het
Vmn1r216	A	G	13: 23,099,891	D248G	probably damaging	Het
Vmn1r34	T	A	6: 66,637,704	M17L	probably benign	Het
Vmn2r120	T	A	17: 57,536,718	D42V	possibly damaging	Het
Vmn2r6	A	T	3: 64,538,250	S685T	possibly damaging	Het
Vsig10l	T	C	7: 43,468,086	V701A	probably benign	Het
Wdfy3	A	G	5: 101,924,095		probably benign	Het
Zfp808	T	A	13: 62,171,730	C258S	possibly damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1519:Actn1	UTSW	12	80205078	missense	probably damaging	1.00
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R4972:Actn1	UTSW	12	80173039	missense	probably benign	0.35
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R6709:Actn1	UTSW	12	80193644	missense	probably damaging	1.00
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7116:Actn1	UTSW	12	80204977	missense	probably damaging	1.00
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7183:Actn1	UTSW	12	80168932	missense	possibly damaging	0.87
R7291:Actn1	UTSW	12	80174085	missense	probably benign	0.00
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null
R8469:Actn1	UTSW	12	80193683	missense	possibly damaging	0.95
R8794:Actn1	UTSW	12	80198980	critical splice donor site	probably benign
R8887:Actn1	UTSW	12	80168423	missense	probably damaging	1.00
R9237:Actn1	UTSW	12	80193696	missense	possibly damaging	0.92
R9269:Actn1	UTSW	12	80172971	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGAGCTGAAAATAATGAACCCAGCC -3'
(R):5'- TCTGTTATATGTATGCACGCACG -3'

Sequencing Primer
(F):5'- TAATGAACCCAGCCAGCCAG -3'
(R):5'- GTATGCACGCACGTATTCTACAG -3'

Posted On

2015-04-30