Incidental Mutation 'R4024:Bhmt2'
ID313418
Institutional Source Beutler Lab
Gene Symbol Bhmt2
Ensembl Gene ENSMUSG00000042118
Gene Namebetaine-homocysteine methyltransferase 2
SynonymsC81077, D13Ucla2
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93655720-93674302 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 93663331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015941]
Predicted Effect probably benign
Transcript: ENSMUST00000015941
SMART Domains Protein: ENSMUSP00000015941
Gene: ENSMUSG00000042118

DomainStartEndE-ValueType
Pfam:S-methyl_trans 23 305 3.9e-44 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Bhmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Bhmt2 APN 13 93666771 splice site probably benign
IGL01665:Bhmt2 APN 13 93663153 nonsense probably null
IGL02059:Bhmt2 APN 13 93666663 missense probably benign
IGL02239:Bhmt2 APN 13 93663179 missense probably benign 0.00
IGL02267:Bhmt2 APN 13 93669346 missense probably damaging 1.00
IGL03148:Bhmt2 APN 13 93666653 missense possibly damaging 0.48
R1171:Bhmt2 UTSW 13 93662329 missense probably benign 0.00
R1517:Bhmt2 UTSW 13 93662339 missense probably damaging 0.97
R1886:Bhmt2 UTSW 13 93662490 missense probably benign 0.02
R2167:Bhmt2 UTSW 13 93662504 missense probably benign 0.29
R4823:Bhmt2 UTSW 13 93663290 missense probably benign
R5273:Bhmt2 UTSW 13 93666578 missense possibly damaging 0.84
R5333:Bhmt2 UTSW 13 93671430 missense probably benign 0.00
R5738:Bhmt2 UTSW 13 93663290 missense probably benign
R5955:Bhmt2 UTSW 13 93663197 missense probably benign 0.00
R6281:Bhmt2 UTSW 13 93663160 missense probably damaging 1.00
R6858:Bhmt2 UTSW 13 93671440 missense probably damaging 0.97
R6934:Bhmt2 UTSW 13 93662311 missense probably benign 0.18
R6985:Bhmt2 UTSW 13 93663322 missense possibly damaging 0.64
R7185:Bhmt2 UTSW 13 93663271 missense probably benign 0.22
R7639:Bhmt2 UTSW 13 93663314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCTGGGAGGTCCACAAAC -3'
(R):5'- TAACCGCTAAACTGGCTTCTAAG -3'

Sequencing Primer
(F):5'- GAGGTCCACAAACCCTCCCTTG -3'
(R):5'- GCTAAACTGGCTTCTAAGATTGATTG -3'
Posted On2015-04-30