Incidental Mutation 'R4024:Colec10'
ID313422
Institutional Source Beutler Lab
Gene Symbol Colec10
Ensembl Gene ENSMUSG00000038591
Gene Namecollectin sub-family member 10
SynonymsCL-L1
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location54410774-54466358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54462551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 259 (D259G)
Ref Sequence ENSEMBL: ENSMUSP00000037867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036737]
Predicted Effect probably damaging
Transcript: ENSMUST00000036737
AA Change: D259G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037867
Gene: ENSMUSG00000038591
AA Change: D259G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Collagen 44 96 1.4e-9 PFAM
Pfam:Collagen 65 123 4.3e-10 PFAM
CLECT 148 271 1.09e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227121
Meta Mutation Damage Score 0.8726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Colec10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Colec10 APN 15 54459761 missense probably damaging 0.98
BB002:Colec10 UTSW 15 54462371 missense probably damaging 0.97
BB012:Colec10 UTSW 15 54462371 missense probably damaging 0.97
R0004:Colec10 UTSW 15 54410875 missense possibly damaging 0.57
R0060:Colec10 UTSW 15 54439146 splice site probably benign
R0060:Colec10 UTSW 15 54439146 splice site probably benign
R0827:Colec10 UTSW 15 54462584 missense probably damaging 1.00
R1238:Colec10 UTSW 15 54462439 missense possibly damaging 0.75
R1551:Colec10 UTSW 15 54462262 missense probably damaging 1.00
R2371:Colec10 UTSW 15 54462400 missense possibly damaging 0.84
R4023:Colec10 UTSW 15 54462551 missense probably damaging 1.00
R4628:Colec10 UTSW 15 54459731 missense possibly damaging 0.68
R5893:Colec10 UTSW 15 54410789 missense probably benign 0.18
R6062:Colec10 UTSW 15 54459807 missense possibly damaging 0.93
R6489:Colec10 UTSW 15 54462213 splice site probably null
R6775:Colec10 UTSW 15 54435023 missense possibly damaging 0.95
R6928:Colec10 UTSW 15 54462606 missense probably damaging 1.00
R7124:Colec10 UTSW 15 54462371 missense probably damaging 0.97
R7925:Colec10 UTSW 15 54462371 missense probably damaging 0.97
R8208:Colec10 UTSW 15 54462300 missense possibly damaging 0.62
R8363:Colec10 UTSW 15 54410842 missense probably benign
RF003:Colec10 UTSW 15 54462391 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CCAAGAGTGGTTTCTTCAGAGTG -3'
(R):5'- AAGGTCTCCAAGAGTGTTCCAAG -3'

Sequencing Primer
(F):5'- CTTCAGAGTGTTCATTGGGGTC -3'
(R):5'- GGTCTCCAAGAGTGTTCCAAGTAAAC -3'
Posted On2015-04-30