Incidental Mutation 'R4024:Cndp1'
ID313426
Institutional Source Beutler Lab
Gene Symbol Cndp1
Ensembl Gene ENSMUSG00000056162
Gene Namecarnosine dipeptidase 1 (metallopeptidase M20 family)
SynonymsCn1
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84610509-84650084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84628813 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 250 (D250G)
Ref Sequence ENSEMBL: ENSMUSP00000069699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070139]
Predicted Effect probably damaging
Transcript: ENSMUST00000070139
AA Change: D250G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069699
Gene: ENSMUSG00000056162
AA Change: D250G

DomainStartEndE-ValueType
Pfam:Peptidase_M20 103 477 4.3e-33 PFAM
Pfam:M20_dimer 216 377 3.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145981
Meta Mutation Damage Score 0.5997 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Cndp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Cndp1 APN 18 84611665 missense probably benign 0.05
IGL01326:Cndp1 APN 18 84622232 missense probably benign 0.01
IGL01762:Cndp1 APN 18 84622286 missense probably damaging 1.00
IGL02061:Cndp1 APN 18 84634626 missense probably damaging 1.00
IGL02731:Cndp1 APN 18 84631958 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0285:Cndp1 UTSW 18 84618238 missense possibly damaging 0.72
R0494:Cndp1 UTSW 18 84619533 missense probably benign 0.01
R0967:Cndp1 UTSW 18 84634652 splice site probably benign
R0968:Cndp1 UTSW 18 84634652 splice site probably benign
R0969:Cndp1 UTSW 18 84634652 splice site probably benign
R1069:Cndp1 UTSW 18 84634652 splice site probably benign
R1170:Cndp1 UTSW 18 84611625 missense probably benign 0.00
R1340:Cndp1 UTSW 18 84634652 splice site probably benign
R1414:Cndp1 UTSW 18 84634652 splice site probably benign
R1432:Cndp1 UTSW 18 84634652 splice site probably benign
R1891:Cndp1 UTSW 18 84619633 missense probably null 1.00
R3912:Cndp1 UTSW 18 84631999 missense probably benign 0.00
R4238:Cndp1 UTSW 18 84618217 missense probably benign
R4564:Cndp1 UTSW 18 84622286 missense probably damaging 1.00
R4989:Cndp1 UTSW 18 84631900 missense probably damaging 0.99
R5015:Cndp1 UTSW 18 84631911 missense probably damaging 1.00
R5108:Cndp1 UTSW 18 84632061 missense probably damaging 1.00
R5502:Cndp1 UTSW 18 84632013 missense possibly damaging 0.56
R5835:Cndp1 UTSW 18 84612833 missense probably benign 0.00
R6396:Cndp1 UTSW 18 84632010 missense probably benign
R6549:Cndp1 UTSW 18 84636184 missense probably benign 0.04
R7251:Cndp1 UTSW 18 84622197 missense probably benign
R7465:Cndp1 UTSW 18 84619541 missense probably damaging 1.00
R7638:Cndp1 UTSW 18 84636049 missense probably benign 0.36
R7812:Cndp1 UTSW 18 84637869 missense probably benign
R7921:Cndp1 UTSW 18 84622258 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGAGCAGACTTATCAGTTCATG -3'
(R):5'- AAGAGCCCCAAGTCATGTGAC -3'

Sequencing Primer
(F):5'- TAACACACAGCGCGGGC -3'
(R):5'- CATAGGATGTGAGGTCAGGTC -3'
Posted On2015-04-30