Incidental Mutation 'R4025:Mctp2'
ID313442
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Namemultiple C2 domains, transmembrane 2
SynonymsLOC244049
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R4025 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location72077830-72306608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72090239 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 801 (C801F)
Ref Sequence ENSEMBL: ENSMUSP00000078302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323] [ENSMUST00000206466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079323
AA Change: C801F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: C801F

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206466
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl7 A G 15: 26,552,819 S121P probably benign Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nutm2 A G 13: 50,469,353 I29V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Olfr985 T C 9: 40,127,500 T154A probably benign Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ppm1d T A 11: 85,345,757 I454N probably benign Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc22a20 T C 19: 5,985,780 T121A probably damaging Het
Slc4a3 T C 1: 75,549,041 S262P probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 72185815 missense probably damaging 0.96
IGL01296:Mctp2 APN 7 72228526 missense probably benign 0.03
IGL01509:Mctp2 APN 7 72259269 missense probably benign 0.01
IGL02074:Mctp2 APN 7 72161258 missense probably damaging 0.99
IGL02185:Mctp2 APN 7 72080823 missense probably benign 0.13
IGL02238:Mctp2 APN 7 72090205 nonsense probably null
IGL02707:Mctp2 APN 7 72259341 missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 72245542 missense probably damaging 0.99
IGL02869:Mctp2 APN 7 72228471 critical splice donor site probably null
IGL03354:Mctp2 APN 7 72161244 missense probably benign 0.00
IGL03397:Mctp2 APN 7 72259277 missense probably damaging 0.98
IGL03407:Mctp2 APN 7 72211652 missense probably benign 0.05
F5770:Mctp2 UTSW 7 72121751 splice site probably benign
PIT4131001:Mctp2 UTSW 7 72090257 missense probably damaging 1.00
R0013:Mctp2 UTSW 7 72229408 missense probably benign 0.00
R0079:Mctp2 UTSW 7 72214116 splice site probably benign
R0083:Mctp2 UTSW 7 72228516 missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 72247107 critical splice donor site probably null
R0302:Mctp2 UTSW 7 72090264 missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 72080822 missense probably benign 0.00
R0675:Mctp2 UTSW 7 72083170 missense probably damaging 1.00
R1076:Mctp2 UTSW 7 72185867 critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 72259139 missense probably benign
R1356:Mctp2 UTSW 7 72164723 unclassified probably benign
R1628:Mctp2 UTSW 7 72211589 splice site probably null
R1649:Mctp2 UTSW 7 72161258 missense probably damaging 0.99
R1981:Mctp2 UTSW 7 72164698 missense probably benign 0.01
R2256:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2257:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2327:Mctp2 UTSW 7 72211610 missense probably damaging 0.99
R2407:Mctp2 UTSW 7 72200407 missense probably benign 0.40
R2471:Mctp2 UTSW 7 72161161 nonsense probably null
R3706:Mctp2 UTSW 7 72214111 splice site probably benign
R4023:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 72259337 missense probably benign
R4272:Mctp2 UTSW 7 72259331 missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 72183851 missense probably damaging 1.00
R4654:Mctp2 UTSW 7 72090194 missense probably damaging 1.00
R4815:Mctp2 UTSW 7 72259349 missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 72259269 missense probably benign 0.00
R5389:Mctp2 UTSW 7 72214087 missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 72245459 critical splice donor site probably null
R5878:Mctp2 UTSW 7 72214108 missense probably benign 0.01
R5918:Mctp2 UTSW 7 72228540 missense probably damaging 1.00
R5956:Mctp2 UTSW 7 72259175 missense probably benign
R5964:Mctp2 UTSW 7 72103177 missense probably damaging 0.97
R5978:Mctp2 UTSW 7 72090188 missense probably damaging 1.00
R6054:Mctp2 UTSW 7 72259103 missense probably benign
R6475:Mctp2 UTSW 7 72200344 critical splice donor site probably null
R6849:Mctp2 UTSW 7 72211718 missense probably damaging 1.00
R6963:Mctp2 UTSW 7 72228056 missense probably damaging 1.00
R7366:Mctp2 UTSW 7 72259214 missense probably benign 0.00
R7468:Mctp2 UTSW 7 72211690 missense probably damaging 1.00
R7746:Mctp2 UTSW 7 72185796 missense probably benign
R7765:Mctp2 UTSW 7 72090331 intron probably null
R7822:Mctp2 UTSW 7 72127187 missense possibly damaging 0.90
X0066:Mctp2 UTSW 7 72259280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGTGTTCATTCCCCAAATG -3'
(R):5'- ACAGGGTCTTCTGATTGTCTC -3'

Sequencing Primer
(F):5'- GAAGTGTTCATTCCCCAAATGTTTTC -3'
(R):5'- TCTCAAGTGACTTGTCAAATATGC -3'
Posted On2015-04-30