Incidental Mutation 'R4025:Olfr985'
ID313447
Institutional Source Beutler Lab
Gene Symbol Olfr985
Ensembl Gene ENSMUSG00000049073
Gene Nameolfactory receptor 985
SynonymsGA_x6K02T2PVTD-33825763-33824828, mOR171-4
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4025 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40126308-40130184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40127500 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000149371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060345] [ENSMUST00000214981]
Predicted Effect probably benign
Transcript: ENSMUST00000060345
AA Change: T154A

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058372
Gene: ENSMUSG00000049073
AA Change: T154A

DomainStartEndE-ValueType
Pfam:7tm_4 28 308 2.1e-56 PFAM
Pfam:7tm_1 41 290 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214981
AA Change: T154A

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl7 A G 15: 26,552,819 S121P probably benign Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nutm2 A G 13: 50,469,353 I29V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ppm1d T A 11: 85,345,757 I454N probably benign Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc22a20 T C 19: 5,985,780 T121A probably damaging Het
Slc4a3 T C 1: 75,549,041 S262P probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Olfr985
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:Olfr985 APN 9 40127265 missense probably benign 0.00
PIT4514001:Olfr985 UTSW 9 40127299 missense probably damaging 1.00
R4613:Olfr985 UTSW 9 40127722 nonsense probably null
R4876:Olfr985 UTSW 9 40127218 missense probably damaging 1.00
R7772:Olfr985 UTSW 9 40127365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCCTCTTTAGAGTGGATGC -3'
(R):5'- CGTATTCTGATTGTATGGCTCAGC -3'

Sequencing Primer
(F):5'- TGCTGGACAGGATGAACCC -3'
(R):5'- CTGATTGTATGGCTCAGCTGTTC -3'
Posted On2015-04-30