Incidental Mutation 'R4025:Ppm1d'
ID 313455
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4025 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85345757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 454 (I454N)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835]
AlphaFold Q9QZ67
Predicted Effect probably benign
Transcript: ENSMUST00000020835
AA Change: I454N

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: I454N

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl7 A G 15: 26,552,819 S121P probably benign Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nutm2 A G 13: 50,469,353 I29V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Olfr985 T C 9: 40,127,500 T154A probably benign Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc22a20 T C 19: 5,985,780 T121A probably damaging Het
Slc4a3 T C 1: 75,549,041 S262P probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGAGTTCGTGCCATGC -3'
(R):5'- GCTGGAGGGGTTCTTTCAAC -3'

Sequencing Primer
(F):5'- TTGTATACCAGGCTGGCCTCAG -3'
(R):5'- CATTTGACCTGGAGTTGACATC -3'
Posted On 2015-04-30