Incidental Mutation 'R4025:Nutm2'
ID313459
Institutional Source Beutler Lab
Gene Symbol Nutm2
Ensembl Gene ENSMUSG00000071909
Gene NameNUT family member 2
SynonymsLOC328250, Gm806
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4025 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location50467307-50475355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50469353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 29 (I29V)
Ref Sequence ENSEMBL: ENSMUSP00000094390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096633]
Predicted Effect probably benign
Transcript: ENSMUST00000096633
AA Change: I29V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094390
Gene: ENSMUSG00000071909
AA Change: I29V

DomainStartEndE-ValueType
Pfam:NUT 27 733 9e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185962
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl7 A G 15: 26,552,819 S121P probably benign Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Olfr985 T C 9: 40,127,500 T154A probably benign Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ppm1d T A 11: 85,345,757 I454N probably benign Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc22a20 T C 19: 5,985,780 T121A probably damaging Het
Slc4a3 T C 1: 75,549,041 S262P probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Nutm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nutm2 APN 13 50474860 missense probably benign 0.18
IGL01087:Nutm2 APN 13 50469629 missense probably damaging 1.00
IGL01707:Nutm2 APN 13 50469717 missense probably damaging 0.96
IGL02085:Nutm2 APN 13 50473793 splice site probably null
IGL02238:Nutm2 APN 13 50471039 missense probably damaging 1.00
IGL02369:Nutm2 APN 13 50469908 missense probably benign 0.16
IGL02429:Nutm2 APN 13 50469480 missense probably benign 0.44
IGL03083:Nutm2 APN 13 50467444 missense probably damaging 0.98
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0321:Nutm2 UTSW 13 50472955 missense probably damaging 0.98
R1481:Nutm2 UTSW 13 50469481 missense probably damaging 0.99
R1605:Nutm2 UTSW 13 50469919 missense possibly damaging 0.68
R1679:Nutm2 UTSW 13 50469386 missense probably benign 0.17
R1744:Nutm2 UTSW 13 50469354 missense probably benign 0.03
R1768:Nutm2 UTSW 13 50473116 missense probably damaging 1.00
R1969:Nutm2 UTSW 13 50473842 missense probably damaging 1.00
R2026:Nutm2 UTSW 13 50474820 missense probably benign 0.00
R2187:Nutm2 UTSW 13 50467417 missense probably benign 0.00
R3912:Nutm2 UTSW 13 50472940 missense possibly damaging 0.92
R4367:Nutm2 UTSW 13 50469884 missense probably benign 0.01
R4668:Nutm2 UTSW 13 50472997 missense probably benign 0.18
R4940:Nutm2 UTSW 13 50474873 missense possibly damaging 0.58
R4987:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R4988:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R5821:Nutm2 UTSW 13 50469855 missense probably benign 0.01
R5986:Nutm2 UTSW 13 50474460 missense probably damaging 1.00
R6189:Nutm2 UTSW 13 50469738 missense possibly damaging 0.91
R7101:Nutm2 UTSW 13 50472898 missense probably benign 0.00
R7192:Nutm2 UTSW 13 50473069 missense probably damaging 1.00
R7394:Nutm2 UTSW 13 50470007 missense probably damaging 1.00
R7591:Nutm2 UTSW 13 50473867 missense probably damaging 0.98
X0028:Nutm2 UTSW 13 50472954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGTTGAACTCAGCAGGGAAC -3'
(R):5'- TCCAAGCTGTACAATGTTCAGAG -3'

Sequencing Primer
(F):5'- GTTGAACTCAGCAGGGAACTTACTC -3'
(R):5'- TTCAGAGGAACAGCGGCACTC -3'
Posted On2015-04-30