Incidental Mutation 'R4025:Fbxl7'
ID313463
Institutional Source Beutler Lab
Gene Symbol Fbxl7
Ensembl Gene ENSMUSG00000043556
Gene NameF-box and leucine-rich repeat protein 7
SynonymsD230018M15Rik, Fbl6, FBL7
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4025 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location26540459-26895580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26552819 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000061305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059204]
Predicted Effect probably benign
Transcript: ENSMUST00000059204
AA Change: S121P

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061305
Gene: ENSMUSG00000043556
AA Change: S121P

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 73 79 N/A INTRINSIC
FBOX 117 157 2.7e-11 SMART
LRR_CC 185 210 2e-7 SMART
LRR_CC 211 236 2.1e-7 SMART
LRR 237 262 6.3e-7 SMART
LRR 271 296 3.5e-1 SMART
LRR_CC 297 322 1.7e-8 SMART
LRR_CC 323 348 5.5e-8 SMART
LRR_CC 349 374 6.5e-8 SMART
LRR_CC 375 400 9.1e-10 SMART
LRR_CC 401 426 2.1e-8 SMART
LRR_CC 427 452 1.8e-7 SMART
Blast:LRR 453 477 2e-7 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nutm2 A G 13: 50,469,353 I29V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Olfr985 T C 9: 40,127,500 T154A probably benign Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ppm1d T A 11: 85,345,757 I454N probably benign Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc22a20 T C 19: 5,985,780 T121A probably damaging Het
Slc4a3 T C 1: 75,549,041 S262P probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Fbxl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Fbxl7 APN 15 26789563 missense probably damaging 0.98
R0482:Fbxl7 UTSW 15 26543546 missense probably benign 0.06
R1734:Fbxl7 UTSW 15 26543649 missense probably damaging 1.00
R1826:Fbxl7 UTSW 15 26552765 missense possibly damaging 0.59
R1859:Fbxl7 UTSW 15 26543193 missense probably damaging 1.00
R2410:Fbxl7 UTSW 15 26895025 missense possibly damaging 0.79
R3703:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R3704:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R4387:Fbxl7 UTSW 15 26543259 missense probably damaging 1.00
R5055:Fbxl7 UTSW 15 26552936 missense probably damaging 0.98
R5070:Fbxl7 UTSW 15 26789554 missense probably benign 0.15
R5180:Fbxl7 UTSW 15 26543421 missense probably damaging 1.00
R5260:Fbxl7 UTSW 15 26543499 missense probably damaging 1.00
R5720:Fbxl7 UTSW 15 26552893 missense probably damaging 0.98
R6256:Fbxl7 UTSW 15 26553002 missense probably benign 0.16
R6874:Fbxl7 UTSW 15 26552942 missense probably benign
R7143:Fbxl7 UTSW 15 26543158 missense probably benign
R7941:Fbxl7 UTSW 15 26543613 missense probably damaging 1.00
R8848:Fbxl7 UTSW 15 26552816 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGACAATGACAGTCTCCAGC -3'
(R):5'- CACCGACTTTGCCAGGATTTC -3'

Sequencing Primer
(F):5'- ATGACAGTCTCCAGCATGAG -3'
(R):5'- CCGACTTTGCCAGGATTTCAGAATG -3'
Posted On2015-04-30