Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Copa'

313470

Institutional Source

Beutler Lab

Gene Symbol

Copa

Ensembl Gene

ENSMUSG00000026553

Gene Name

coatomer protein complex subunit alpha

Synonyms

xenin

MMRRC Submission

040960-MU

Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172082529-172122330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 172108375 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 428 (V428A)

Ref Sequence

ENSEMBL: ENSMUSP00000027833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000124289] [ENSMUST00000135192]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027833
AA Change: V428A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: V428A

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	776	5.4e-144	PFAM
Pfam:COPI_C	824	1233	1.4e-190	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124289

SMART Domains

Protein: ENSMUSP00000118899
Gene: ENSMUSG00000026553

Domain	Start	End	E-Value	Type
Blast:WD40	1	37	2e-19	BLAST
PDB:4J8G\|B	1	52	2e-23	PDB
SCOP:d1erja_	1	52	1e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126634

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133909

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135192
AA Change: V428A

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: V428A

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	767	1.1e-148	PFAM
Pfam:COPI_C	815	1224	3.6e-216	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152403

SMART Domains

Protein: ENSMUSP00000123214
Gene: ENSMUSG00000026553

Domain	Start	End	E-Value	Type
WD40	14	53	8.42e-7	SMART
WD40	56	94	1.38e1	SMART

Meta Mutation Damage Score

0.3104

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Acss2	C	T	2: 155,557,210	T477I	probably damaging	Het
Aplp2	G	A	9: 31,157,730	P601L	probably benign	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Elf1	A	C	14: 79,569,283	K161Q	probably damaging	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hyal4	A	G	6: 24,756,224	E147G	probably damaging	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Copa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Copa	APN	1	172110688	missense	possibly damaging	0.87
IGL01360:Copa	APN	1	172087588	splice site	probably null
IGL01434:Copa	APN	1	172119561	missense	probably benign	0.00
IGL01744:Copa	APN	1	172113189	missense	probably benign	0.01
IGL01837:Copa	APN	1	172118852	missense	probably benign	0.01
IGL01988:Copa	APN	1	172118264	missense	probably benign	0.09
IGL02059:Copa	APN	1	172099753	missense	probably damaging	0.96
IGL02123:Copa	APN	1	172112128	missense	probably damaging	1.00
IGL02731:Copa	APN	1	172102218	missense	possibly damaging	0.77
IGL03114:Copa	APN	1	172119268	nonsense	probably null
P0027:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
PIT4434001:Copa	UTSW	1	172106175	missense	probably benign	0.00
R0233:Copa	UTSW	1	172087667	critical splice donor site	probably null
R0465:Copa	UTSW	1	172118305	missense	probably damaging	1.00
R0547:Copa	UTSW	1	172121687	splice site	probably benign
R0568:Copa	UTSW	1	172112137	missense	possibly damaging	0.91
R0628:Copa	UTSW	1	172091025	splice site	probably benign
R1328:Copa	UTSW	1	172121691	splice site	probably benign
R1494:Copa	UTSW	1	172104127	missense	probably benign	0.27
R1728:Copa	UTSW	1	172111987	missense	probably benign
R1758:Copa	UTSW	1	172104144	missense	probably damaging	1.00
R1784:Copa	UTSW	1	172111987	missense	probably benign
R1942:Copa	UTSW	1	172111888	missense	probably damaging	1.00
R2054:Copa	UTSW	1	172118957	nonsense	probably null
R2299:Copa	UTSW	1	172121725	missense	probably benign	0.10
R2518:Copa	UTSW	1	172119901	missense	probably benign
R2680:Copa	UTSW	1	172121404	nonsense	probably null
R3080:Copa	UTSW	1	172113149	missense	probably damaging	1.00
R3160:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3161:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3973:Copa	UTSW	1	172121245	missense	probably benign	0.00
R3975:Copa	UTSW	1	172121245	missense	probably benign	0.00
R4155:Copa	UTSW	1	172101425	missense	probably damaging	1.00
R4227:Copa	UTSW	1	172118115	intron	probably benign
R4244:Copa	UTSW	1	172110718	missense	probably benign	0.00
R4254:Copa	UTSW	1	172102244	missense	probably damaging	1.00
R4291:Copa	UTSW	1	172092397	intron	probably benign
R4323:Copa	UTSW	1	172119264	missense	probably damaging	1.00
R4402:Copa	UTSW	1	172102224	missense	probably damaging	1.00
R4711:Copa	UTSW	1	172119988	missense	probably damaging	1.00
R4721:Copa	UTSW	1	172104274	splice site	probably benign
R4773:Copa	UTSW	1	172105220	missense	probably damaging	1.00
R4794:Copa	UTSW	1	172119321	missense	probably damaging	1.00
R4887:Copa	UTSW	1	172092276	missense	probably benign	0.39
R4953:Copa	UTSW	1	172082886	unclassified	probably benign
R5139:Copa	UTSW	1	172121329	missense	probably damaging	0.99
R5152:Copa	UTSW	1	172118061	missense	probably benign	0.34
R5297:Copa	UTSW	1	172113108	missense	probably damaging	1.00
R5586:Copa	UTSW	1	172105222	missense	probably damaging	1.00
R5698:Copa	UTSW	1	172118944	nonsense	probably null
R6283:Copa	UTSW	1	172118848	missense	possibly damaging	0.79
R6921:Copa	UTSW	1	172111924	missense	possibly damaging	0.63
R6934:Copa	UTSW	1	172110686	missense	possibly damaging	0.64
R7009:Copa	UTSW	1	172091000	missense	probably damaging	0.96
R7194:Copa	UTSW	1	172119944	missense	probably damaging	0.99
R7348:Copa	UTSW	1	172102223	missense	possibly damaging	0.96
R7710:Copa	UTSW	1	172109844	missense	possibly damaging	0.50
R7745:Copa	UTSW	1	172111942	missense	probably damaging	1.00
R7893:Copa	UTSW	1	172119565	nonsense	probably null
R8168:Copa	UTSW	1	172099672	missense	probably damaging	1.00
R8273:Copa	UTSW	1	172118979	critical splice donor site	probably null
T0722:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
Z1177:Copa	UTSW	1	172106123	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCTAGAGATAAGAGGCTTGGC -3'
(R):5'- TCCAGATTCAGAAGCCAGAGG -3'

Sequencing Primer
(F):5'- TCACTGACAATAGCCCGAGGTTATG -3'
(R):5'- TTCAGAAGCCAGAGGTCTAGTAACAC -3'

Posted On

2015-04-30