Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Acss2'

313479

Institutional Source

Beutler Lab

Gene Symbol

Acss2

Ensembl Gene

ENSMUSG00000027605

Gene Name

acyl-CoA synthetase short-chain family member 2

Synonyms

Acas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1

MMRRC Submission

040960-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.429) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155517948-155585724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 155557210 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 477 (T477I)

Ref Sequence

ENSEMBL: ENSMUSP00000099431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029135] [ENSMUST00000065973] [ENSMUST00000103142] [ENSMUST00000133654]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029135
AA Change: T464I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029135
Gene: ENSMUSG00000027605
AA Change: T464I

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	575	1.9e-96	PFAM
Pfam:AMP-binding_C	583	661	2.4e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000065973
AA Change: T464I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605
AA Change: T464I

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	575	4.8e-98	PFAM
Pfam:AMP-binding_C	583	660	3.1e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000103142
AA Change: T477I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099431
Gene: ENSMUSG00000027605
AA Change: T477I

Domain	Start	End	E-Value	Type
Pfam:ACAS_N	47	107	8.1e-21	PFAM
Pfam:AMP-binding	108	588	4.7e-97	PFAM
Pfam:AMP-binding_C	596	674	1.3e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131054

Predicted Effect

probably benign
Transcript: ENSMUST00000133654

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148685

Predicted Effect

unknown
Transcript: ENSMUST00000151781
AA Change: T268I

SMART Domains

Protein: ENSMUSP00000122545
Gene: ENSMUSG00000027605
AA Change: T268I

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	1	187	1.2e-32	PFAM
Pfam:AMP-binding	187	292	1.2e-15	PFAM

Meta Mutation Damage Score

0.8688

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Aplp2	G	A	9: 31,157,730	P601L	probably benign	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Copa	T	C	1: 172,108,375	V428A	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Elf1	A	C	14: 79,569,283	K161Q	probably damaging	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hyal4	A	G	6: 24,756,224	E147G	probably damaging	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Acss2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01146:Acss2	APN	2	155562037	missense	possibly damaging	0.83
IGL02333:Acss2	APN	2	155555884	missense	probably damaging	1.00
IGL03278:Acss2	APN	2	155562001	missense	possibly damaging	0.64
IGL03392:Acss2	APN	2	155562011	missense	probably damaging	1.00
BB009:Acss2	UTSW	2	155573180	missense	unknown
BB019:Acss2	UTSW	2	155573180	missense	unknown
R1159:Acss2	UTSW	2	155551218	missense	probably benign
R1293:Acss2	UTSW	2	155551221	missense	probably benign
R1639:Acss2	UTSW	2	155556908	missense	probably benign	0.01
R1725:Acss2	UTSW	2	155556844	missense	possibly damaging	0.56
R1834:Acss2	UTSW	2	155558630	missense	probably damaging	1.00
R1835:Acss2	UTSW	2	155558630	missense	probably damaging	1.00
R1836:Acss2	UTSW	2	155558630	missense	probably damaging	1.00
R2361:Acss2	UTSW	2	155558669	missense	probably damaging	0.98
R3899:Acss2	UTSW	2	155557237	splice site	probably benign
R4008:Acss2	UTSW	2	155557628	missense	probably damaging	1.00
R4009:Acss2	UTSW	2	155557628	missense	probably damaging	1.00
R4010:Acss2	UTSW	2	155557628	missense	probably damaging	1.00
R4011:Acss2	UTSW	2	155557628	missense	probably damaging	1.00
R4117:Acss2	UTSW	2	155556393	missense	probably damaging	1.00
R4515:Acss2	UTSW	2	155556363	missense	probably benign	0.39
R4756:Acss2	UTSW	2	155561143	missense	probably damaging	1.00
R4895:Acss2	UTSW	2	155550481	splice site	probably benign
R5327:Acss2	UTSW	2	155573229	missense	probably null
R5654:Acss2	UTSW	2	155574655	unclassified	probably benign
R5717:Acss2	UTSW	2	155561153	missense	probably damaging	1.00
R5743:Acss2	UTSW	2	155574616	unclassified	probably benign
R5773:Acss2	UTSW	2	155574694	splice site	probably null
R5825:Acss2	UTSW	2	155549178	splice site	probably null
R5979:Acss2	UTSW	2	155522109	missense	possibly damaging	0.75
R6525:Acss2	UTSW	2	155550417	missense	probably benign
R6551:Acss2	UTSW	2	155551208	missense	probably benign
R6785:Acss2	UTSW	2	155560685	missense	probably damaging	1.00
R6976:Acss2	UTSW	2	155556009	splice site	probably null
R7074:Acss2	UTSW	2	155522041	missense	possibly damaging	0.94
R7372:Acss2	UTSW	2	155557180	missense	probably damaging	0.99
R7448:Acss2	UTSW	2	155518266	missense	probably damaging	1.00
R7528:Acss2	UTSW	2	155557146	missense	probably damaging	1.00
R7541:Acss2	UTSW	2	155574690	critical splice donor site	probably null
R7543:Acss2	UTSW	2	155549835	missense	probably damaging	0.98
R7754:Acss2	UTSW	2	155561166	missense	probably benign	0.00
R7846:Acss2	UTSW	2	155561033	missense	probably damaging	1.00
R7932:Acss2	UTSW	2	155573180	missense	unknown
R8011:Acss2	UTSW	2	155555957	missense	possibly damaging	0.73
R8424:Acss2	UTSW	2	155574618	missense	unknown
Z1177:Acss2	UTSW	2	155517957	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAACTCTGACTGCATGTGC -3'
(R):5'- GGCCAGAACCCTACTCTAATAGG -3'

Sequencing Primer
(F):5'- CATGTGCATTTTGGCTCCTAG -3'
(R):5'- TATCCCTGCCAAGCCTAGG -3'

Posted On

2015-04-30