Incidental Mutation 'R4031:Spo11'
ID313480
Institutional Source Beutler Lab
Gene Symbol Spo11
Ensembl Gene ENSMUSG00000005883
Gene NameSPO11 meiotic protein covalently bound to DSB
Synonyms
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172977700-172993576 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 172986832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050442] [ENSMUST00000109125] [ENSMUST00000109126]
Predicted Effect probably benign
Transcript: ENSMUST00000050442
SMART Domains Protein: ENSMUSP00000059056
Gene: ENSMUSG00000005883

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 6.3e-28 PFAM
Pfam:TP6A_N 107 170 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109125
SMART Domains Protein: ENSMUSP00000104753
Gene: ENSMUSG00000005883

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1e-30 PFAM
Pfam:TP6A_N 66 133 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109126
SMART Domains Protein: ENSMUSP00000104754
Gene: ENSMUSG00000005883

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1.1e-30 PFAM
Pfam:TP6A_N 102 146 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156471
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Mutant males exhibit loss of spermatocytes in early prophase, while mutant females exhibit oocyte loss soon after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Spo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Spo11 APN 2 172989032 critical splice donor site probably null
IGL02080:Spo11 APN 2 172989395 missense probably damaging 1.00
IGL02309:Spo11 APN 2 172979951 missense probably damaging 0.98
R3027:Spo11 UTSW 2 172985943 missense probably damaging 0.99
R5000:Spo11 UTSW 2 172989400 missense probably damaging 1.00
R5443:Spo11 UTSW 2 172989359 splice site probably benign
R7185:Spo11 UTSW 2 172982192 intron probably null
R7486:Spo11 UTSW 2 172984077 missense probably benign 0.01
R7565:Spo11 UTSW 2 172992071 missense possibly damaging 0.65
X0061:Spo11 UTSW 2 172993050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAACCGTCTCTGTTTGGG -3'
(R):5'- ATCTATATCCACCCAGGTGTACC -3'

Sequencing Primer
(F):5'- CTCTGTTTGGGAAGCCACAG -3'
(R):5'- CAGGGCCTGGCTTATTCCAC -3'
Posted On2015-04-30