Incidental Mutation 'R4031:Rap1gds1'
ID313481
Institutional Source Beutler Lab
Gene Symbol Rap1gds1
Ensembl Gene ENSMUSG00000028149
Gene NameRAP1, GTP-GDP dissociation stimulator 1
SynonymsGDS1
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138925902-139075201 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 139050592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029796] [ENSMUST00000098574] [ENSMUST00000196106] [ENSMUST00000196280] [ENSMUST00000200396]
Predicted Effect probably benign
Transcript: ENSMUST00000029796
SMART Domains Protein: ENSMUSP00000029796
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 119 162 7.98e-4 SMART
ARM 297 341 2.4e-7 SMART
ARM 342 382 6.3e1 SMART
ARM 430 470 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098574
SMART Domains Protein: ENSMUSP00000096173
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 479 519 6.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195953
Predicted Effect probably benign
Transcript: ENSMUST00000196106
Predicted Effect probably benign
Transcript: ENSMUST00000196280
SMART Domains Protein: ENSMUSP00000143181
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 478 518 6.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199152
Predicted Effect probably benign
Transcript: ENSMUST00000200396
SMART Domains Protein: ENSMUSP00000143517
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 6.7e-9 SMART
ARM 119 162 3.9e-6 SMART
ARM 297 341 1.2e-9 SMART
ARM 342 382 3.1e-1 SMART
ARM 430 470 3.1e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The smg GDP dissociation stimulator (smgGDS) protein is a stimulatory GDP/GTP exchange protein with GTPase activity (Riess et al., 1993 [PubMed 8262526]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Rap1gds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rap1gds1 APN 3 138983827 missense possibly damaging 0.95
IGL01314:Rap1gds1 APN 3 139050561 missense probably damaging 1.00
IGL01450:Rap1gds1 APN 3 138965920 missense probably damaging 1.00
IGL02033:Rap1gds1 APN 3 138955471 splice site probably benign
IGL02658:Rap1gds1 APN 3 138957479 missense probably damaging 1.00
IGL02745:Rap1gds1 APN 3 138956241 missense probably damaging 1.00
IGL02880:Rap1gds1 APN 3 138945756 missense probably benign 0.16
PIT4305001:Rap1gds1 UTSW 3 138956300 missense probably benign 0.05
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0585:Rap1gds1 UTSW 3 139021872 missense probably benign 0.16
R1573:Rap1gds1 UTSW 3 138965863 splice site probably null
R1793:Rap1gds1 UTSW 3 139050553 missense possibly damaging 0.94
R1960:Rap1gds1 UTSW 3 139050556 missense probably null 0.28
R2432:Rap1gds1 UTSW 3 138956250 missense probably damaging 0.99
R2697:Rap1gds1 UTSW 3 138983721 critical splice donor site probably null
R3792:Rap1gds1 UTSW 3 138965960 missense probably damaging 1.00
R4194:Rap1gds1 UTSW 3 138959090 missense probably damaging 1.00
R4530:Rap1gds1 UTSW 3 138957425 missense probably damaging 1.00
R4696:Rap1gds1 UTSW 3 138927614 missense probably damaging 1.00
R4909:Rap1gds1 UTSW 3 138983748 missense possibly damaging 0.77
R5000:Rap1gds1 UTSW 3 138956250 missense probably damaging 1.00
R5046:Rap1gds1 UTSW 3 138955420 nonsense probably null
R5152:Rap1gds1 UTSW 3 138956201 missense probably damaging 1.00
R5163:Rap1gds1 UTSW 3 138959056 missense probably damaging 0.99
R5309:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5312:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5782:Rap1gds1 UTSW 3 138959079 missense possibly damaging 0.65
R5825:Rap1gds1 UTSW 3 138955375 missense possibly damaging 0.93
R6547:Rap1gds1 UTSW 3 138955338 missense probably damaging 1.00
R7227:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7228:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7574:Rap1gds1 UTSW 3 138956215 nonsense probably null
R7711:Rap1gds1 UTSW 3 138959113 missense probably benign 0.08
RF053:Rap1gds1 UTSW 3 138941657 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTAAACAATGCGGACTTGATCC -3'
(R):5'- AGTCACGGATAATCTGTACTGTTTG -3'

Sequencing Primer
(F):5'- GACTTGATCCATTCTTGGTTTGG -3'
(R):5'- AGGCTAATTCTGCCCAGT -3'
Posted On2015-04-30