Incidental Mutation 'R4031:Dcun1d4'
ID313485
Institutional Source Beutler Lab
Gene Symbol Dcun1d4
Ensembl Gene ENSMUSG00000051674
Gene NameDCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Synonyms
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73481000-73560794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73534637 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000119983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063882] [ENSMUST00000087181] [ENSMUST00000113558] [ENSMUST00000133137] [ENSMUST00000134092] [ENSMUST00000136268] [ENSMUST00000145645]
Predicted Effect probably benign
Transcript: ENSMUST00000063882
AA Change: D149G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067616
Gene: ENSMUSG00000051674
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 173 287 3.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087181
AA Change: D163G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084427
Gene: ENSMUSG00000051674
AA Change: D163G

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:Cullin_binding 189 300 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113558
AA Change: D149G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109187
Gene: ENSMUSG00000051674
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 203 252 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130087
SMART Domains Protein: ENSMUSP00000118392
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:3KEV|A 44 109 3e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133137
SMART Domains Protein: ENSMUSP00000120055
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134092
SMART Domains Protein: ENSMUSP00000118710
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136268
AA Change: D89G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119983
Gene: ENSMUSG00000051674
AA Change: D89G

DomainStartEndE-ValueType
PDB:4GBA|B 42 104 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000145645
AA Change: D89G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122689
Gene: ENSMUSG00000051674
AA Change: D89G

DomainStartEndE-ValueType
PDB:4GBA|B 42 101 1e-7 PDB
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Dcun1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Dcun1d4 APN 5 73481201 splice site probably benign
IGL02345:Dcun1d4 APN 5 73511152 missense probably damaging 0.99
IGL03264:Dcun1d4 APN 5 73520229 missense probably benign 0.00
PIT4402001:Dcun1d4 UTSW 5 73510933 missense probably benign 0.09
R1184:Dcun1d4 UTSW 5 73511112 splice site probably benign
R2266:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2267:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2268:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2269:Dcun1d4 UTSW 5 73481275 splice site probably benign
R4027:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4029:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4788:Dcun1d4 UTSW 5 73534628 missense probably damaging 1.00
R4961:Dcun1d4 UTSW 5 73544120 nonsense probably null
R5245:Dcun1d4 UTSW 5 73557314 missense probably benign 0.11
R5284:Dcun1d4 UTSW 5 73522682 unclassified probably null
R5457:Dcun1d4 UTSW 5 73531565 missense probably damaging 1.00
R5728:Dcun1d4 UTSW 5 73520148 missense possibly damaging 0.61
R6469:Dcun1d4 UTSW 5 73534614 missense probably damaging 0.99
R6813:Dcun1d4 UTSW 5 73520957 missense possibly damaging 0.90
R7165:Dcun1d4 UTSW 5 73491195 splice site probably null
R7439:Dcun1d4 UTSW 5 73491536 critical splice donor site probably null
X0063:Dcun1d4 UTSW 5 73555438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTTTGTCAAACCCAGACTCAC -3'
(R):5'- GAGGCTTGCTACACTACCAG -3'

Sequencing Primer
(F):5'- AGACTCACTCAGTTTTGAAGCC -3'
(R):5'- ATGTCCTAAGTTCCCAGGAGC -3'
Posted On2015-04-30