Incidental Mutation 'R4031:Polr2b'
ID313486
Institutional Source Beutler Lab
Gene Symbol Polr2b
Ensembl Gene ENSMUSG00000029250
Gene Namepolymerase (RNA) II (DNA directed) polypeptide B
SynonymsRPB2
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location77310147-77349324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77348405 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1141 (R1141H)
Ref Sequence ENSEMBL: ENSMUSP00000031167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000046746] [ENSMUST00000163898]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031167
AA Change: R1141H

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250
AA Change: R1141H

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046746
SMART Domains Protein: ENSMUSP00000045057
Gene: ENSMUSG00000036256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 166 266 5.53e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163898
SMART Domains Protein: ENSMUSP00000128318
Gene: ENSMUSG00000036256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 197 297 5.53e-6 SMART
Meta Mutation Damage Score 0.2662 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Polr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Polr2b APN 5 77332252 missense probably benign
IGL02069:Polr2b APN 5 77343197 missense probably benign 0.01
IGL03218:Polr2b APN 5 77315917 missense probably benign 0.03
R0007:Polr2b UTSW 5 77340437 missense probably benign 0.02
R0056:Polr2b UTSW 5 77334535 missense possibly damaging 0.55
R0076:Polr2b UTSW 5 77326561 missense possibly damaging 0.78
R0099:Polr2b UTSW 5 77320950 splice site probably benign
R0114:Polr2b UTSW 5 77343263 missense probably damaging 1.00
R0193:Polr2b UTSW 5 77320076 missense probably damaging 1.00
R0481:Polr2b UTSW 5 77332082 missense possibly damaging 0.90
R0607:Polr2b UTSW 5 77313159 unclassified probably benign
R1233:Polr2b UTSW 5 77334565 missense probably benign
R1597:Polr2b UTSW 5 77326101 missense probably damaging 1.00
R1674:Polr2b UTSW 5 77326623 missense possibly damaging 0.83
R1696:Polr2b UTSW 5 77342648 missense probably benign 0.12
R1704:Polr2b UTSW 5 77342560 missense possibly damaging 0.95
R1871:Polr2b UTSW 5 77326527 splice site probably benign
R2114:Polr2b UTSW 5 77320970 missense probably damaging 1.00
R2137:Polr2b UTSW 5 77320346 missense probably benign 0.18
R2305:Polr2b UTSW 5 77320437 splice site probably benign
R3921:Polr2b UTSW 5 77326653 missense probably damaging 1.00
R4027:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4526:Polr2b UTSW 5 77326714 missense probably damaging 1.00
R4750:Polr2b UTSW 5 77332039 missense possibly damaging 0.92
R4827:Polr2b UTSW 5 77342551 missense probably benign
R5244:Polr2b UTSW 5 77343000 intron probably benign
R5360:Polr2b UTSW 5 77349146 missense possibly damaging 0.90
R5628:Polr2b UTSW 5 77313216 missense probably damaging 0.98
R5928:Polr2b UTSW 5 77345342 missense probably damaging 1.00
R6009:Polr2b UTSW 5 77320252 missense probably benign
R6179:Polr2b UTSW 5 77320977 missense probably damaging 1.00
R6251:Polr2b UTSW 5 77348294 missense probably benign 0.00
R7209:Polr2b UTSW 5 77343179 missense probably damaging 1.00
R7303:Polr2b UTSW 5 77321021 missense probably benign 0.04
R7328:Polr2b UTSW 5 77315999 missense probably damaging 1.00
R7345:Polr2b UTSW 5 77349119 missense possibly damaging 0.55
R7471:Polr2b UTSW 5 77321066 nonsense probably null
R7581:Polr2b UTSW 5 77326704 missense probably damaging 1.00
R7697:Polr2b UTSW 5 77320212 missense probably damaging 1.00
R7699:Polr2b UTSW 5 77340421 missense probably benign 0.00
R7700:Polr2b UTSW 5 77340421 missense probably benign 0.00
R7995:Polr2b UTSW 5 77325767
R8015:Polr2b UTSW 5 77336506
X0054:Polr2b UTSW 5 77348305 missense probably damaging 0.97
Z1088:Polr2b UTSW 5 77342722 missense possibly damaging 0.95
Z1088:Polr2b UTSW 5 77345401 missense probably damaging 1.00
Z1176:Polr2b UTSW 5 77331971
Predicted Primers PCR Primer
(F):5'- CTTATCAACAGTGATGGTGGCC -3'
(R):5'- GACCTTGCAATTTCAGAGATGAATAGC -3'

Sequencing Primer
(F):5'- ATGGTGGCCTGCGCTTC -3'
(R):5'- AGAGATGAATAGCTTAGTGAAATTGC -3'
Posted On2015-04-30