Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Polr2b'

313486

Institutional Source

Beutler Lab

Gene Symbol

Polr2b

Ensembl Gene

ENSMUSG00000029250

Gene Name

polymerase (RNA) II (DNA directed) polypeptide B

Synonyms

RPB2

MMRRC Submission

040960-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77310147-77349324 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77348405 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1141 (R1141H)

Ref Sequence

ENSEMBL: ENSMUSP00000031167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000046746] [ENSMUST00000163898]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031167
AA Change: R1141H

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250
AA Change: R1141H

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
Pfam:RNA_pol_Rpb2_1	38	442	2.5e-69	PFAM
Pfam:RNA_pol_Rpb2_2	201	394	3.7e-57	PFAM
Pfam:RNA_pol_Rpb2_3	468	532	6.1e-25	PFAM
Pfam:RNA_pol_Rpb2_4	567	629	7.4e-27	PFAM
Pfam:RNA_pol_Rpb2_5	653	700	1.6e-22	PFAM
Pfam:RNA_pol_Rpb2_6	707	1080	4.5e-129	PFAM
Pfam:RNA_pol_Rpb2_7	1082	1174	3.3e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000046746

SMART Domains

Protein: ENSMUSP00000045057
Gene: ENSMUSG00000036256

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
IB	30	113	9.23e-19	SMART
KAZAL	110	156	6.39e-12	SMART
IG	166	266	5.53e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163898

SMART Domains

Protein: ENSMUSP00000128318
Gene: ENSMUSG00000036256

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
IB	30	113	9.23e-19	SMART
KAZAL	110	156	6.39e-12	SMART
IG	197	297	5.53e-6	SMART

Meta Mutation Damage Score

0.2662

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Acss2	C	T	2: 155,557,210	T477I	probably damaging	Het
Aplp2	G	A	9: 31,157,730	P601L	probably benign	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Copa	T	C	1: 172,108,375	V428A	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Elf1	A	C	14: 79,569,283	K161Q	probably damaging	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hyal4	A	G	6: 24,756,224	E147G	probably damaging	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Polr2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02026:Polr2b	APN	5	77332252	missense	probably benign
IGL02069:Polr2b	APN	5	77343197	missense	probably benign	0.01
IGL03218:Polr2b	APN	5	77315917	missense	probably benign	0.03
R0007:Polr2b	UTSW	5	77340437	missense	probably benign	0.02
R0056:Polr2b	UTSW	5	77334535	missense	possibly damaging	0.55
R0076:Polr2b	UTSW	5	77326561	missense	possibly damaging	0.78
R0099:Polr2b	UTSW	5	77320950	splice site	probably benign
R0114:Polr2b	UTSW	5	77343263	missense	probably damaging	1.00
R0193:Polr2b	UTSW	5	77320076	missense	probably damaging	1.00
R0481:Polr2b	UTSW	5	77332082	missense	possibly damaging	0.90
R0607:Polr2b	UTSW	5	77313159	unclassified	probably benign
R1233:Polr2b	UTSW	5	77334565	missense	probably benign
R1597:Polr2b	UTSW	5	77326101	missense	probably damaging	1.00
R1674:Polr2b	UTSW	5	77326623	missense	possibly damaging	0.83
R1696:Polr2b	UTSW	5	77342648	missense	probably benign	0.12
R1704:Polr2b	UTSW	5	77342560	missense	possibly damaging	0.95
R1871:Polr2b	UTSW	5	77326527	splice site	probably benign
R2114:Polr2b	UTSW	5	77320970	missense	probably damaging	1.00
R2137:Polr2b	UTSW	5	77320346	missense	probably benign	0.18
R2305:Polr2b	UTSW	5	77320437	splice site	probably benign
R3921:Polr2b	UTSW	5	77326653	missense	probably damaging	1.00
R4027:Polr2b	UTSW	5	77348405	missense	possibly damaging	0.88
R4526:Polr2b	UTSW	5	77326714	missense	probably damaging	1.00
R4750:Polr2b	UTSW	5	77332039	missense	possibly damaging	0.92
R4827:Polr2b	UTSW	5	77342551	missense	probably benign
R5244:Polr2b	UTSW	5	77343000	intron	probably benign
R5360:Polr2b	UTSW	5	77349146	missense	possibly damaging	0.90
R5628:Polr2b	UTSW	5	77313216	missense	probably damaging	0.98
R5928:Polr2b	UTSW	5	77345342	missense	probably damaging	1.00
R6009:Polr2b	UTSW	5	77320252	missense	probably benign
R6179:Polr2b	UTSW	5	77320977	missense	probably damaging	1.00
R6251:Polr2b	UTSW	5	77348294	missense	probably benign	0.00
R7209:Polr2b	UTSW	5	77343179	missense	probably damaging	1.00
R7303:Polr2b	UTSW	5	77321021	missense	probably benign	0.04
R7328:Polr2b	UTSW	5	77315999	missense	probably damaging	1.00
R7345:Polr2b	UTSW	5	77349119	missense	possibly damaging	0.55
R7471:Polr2b	UTSW	5	77321066	nonsense	probably null
R7581:Polr2b	UTSW	5	77326704	missense	probably damaging	1.00
R7697:Polr2b	UTSW	5	77320212	missense	probably damaging	1.00
R7699:Polr2b	UTSW	5	77340421	missense	probably benign	0.00
R7700:Polr2b	UTSW	5	77340421	missense	probably benign	0.00
R7995:Polr2b	UTSW	5	77325767
R8015:Polr2b	UTSW	5	77336506
X0054:Polr2b	UTSW	5	77348305	missense	probably damaging	0.97
Z1088:Polr2b	UTSW	5	77342722	missense	possibly damaging	0.95
Z1088:Polr2b	UTSW	5	77345401	missense	probably damaging	1.00
Z1176:Polr2b	UTSW	5	77331971

Predicted Primers

PCR Primer
(F):5'- CTTATCAACAGTGATGGTGGCC -3'
(R):5'- GACCTTGCAATTTCAGAGATGAATAGC -3'

Sequencing Primer
(F):5'- ATGGTGGCCTGCGCTTC -3'
(R):5'- AGAGATGAATAGCTTAGTGAAATTGC -3'

Posted On

2015-04-30