Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Hyal4'

313489

Institutional Source

Beutler Lab

Gene Symbol

Hyal4

Ensembl Gene

ENSMUSG00000029680

Gene Name

hyaluronoglucosaminidase 4

Synonyms

MMRRC Submission

040960-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24748329-24767662 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24756224 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 147 (E147G)

Ref Sequence

ENSEMBL: ENSMUSP00000031691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031691]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031691
AA Change: E147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: E147G

Domain	Start	End	E-Value	Type
low complexity region	23	36	N/A	INTRINSIC
Pfam:Glyco_hydro_56	41	373	3e-137	PFAM
EGF	375	447	2.81e0	SMART
low complexity region	453	473	N/A	INTRINSIC

Meta Mutation Damage Score

0.7749

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Acss2	C	T	2: 155,557,210	T477I	probably damaging	Het
Aplp2	G	A	9: 31,157,730	P601L	probably benign	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Copa	T	C	1: 172,108,375	V428A	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Elf1	A	C	14: 79,569,283	K161Q	probably damaging	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Hyal4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Hyal4	APN	6	24755872	missense	probably benign	0.03
IGL01791:Hyal4	APN	6	24763895	splice site	probably benign
IGL02434:Hyal4	APN	6	24763858	nonsense	probably null
IGL02523:Hyal4	APN	6	24765969	missense	probably damaging	0.96
IGL03114:Hyal4	APN	6	24755965	missense	probably benign	0.00
IGL02835:Hyal4	UTSW	6	24765715	missense	probably benign	0.00
PIT4494001:Hyal4	UTSW	6	24755834	missense	probably benign	0.05
R0196:Hyal4	UTSW	6	24756221	missense	probably damaging	1.00
R0323:Hyal4	UTSW	6	24756194	missense	probably benign	0.30
R0398:Hyal4	UTSW	6	24756671	missense	probably damaging	0.97
R0946:Hyal4	UTSW	6	24755913	nonsense	probably null
R0961:Hyal4	UTSW	6	24755746	utr 5 prime	probably benign
R1906:Hyal4	UTSW	6	24756111	missense	probably damaging	1.00
R1998:Hyal4	UTSW	6	24756311	missense	probably benign	0.00
R2085:Hyal4	UTSW	6	24755750	start gained	probably benign
R2483:Hyal4	UTSW	6	24765738	missense	probably damaging	0.96
R3622:Hyal4	UTSW	6	24765738	missense	probably damaging	0.96
R3623:Hyal4	UTSW	6	24765738	missense	probably damaging	0.96
R3624:Hyal4	UTSW	6	24765738	missense	probably damaging	0.96
R3712:Hyal4	UTSW	6	24756514	missense	probably damaging	1.00
R5762:Hyal4	UTSW	6	24765862	missense	possibly damaging	0.93
R6177:Hyal4	UTSW	6	24766090	nonsense	probably null
R6442:Hyal4	UTSW	6	24765850	missense	probably benign	0.08
R6494:Hyal4	UTSW	6	24765746	missense	possibly damaging	0.79
R6901:Hyal4	UTSW	6	24756191	missense	probably damaging	0.97
R7565:Hyal4	UTSW	6	24765934	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TTCAGATGGTTGGAAGCCCTC -3'
(R):5'- TAATAACCCCAAAGGCCCTTGG -3'

Sequencing Primer
(F):5'- CTCGGCTCAAAGACAGGG -3'
(R):5'- AAAGGCCCTTGGGTCTGCTC -3'

Posted On

2015-04-30