Incidental Mutation 'R4031:Vsig10l'
ID313492
Institutional Source Beutler Lab
Gene Symbol Vsig10l
Ensembl Gene ENSMUSG00000070604
Gene NameV-set and immunoglobulin domain containing 10 like
Synonyms
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4031 (G1)
Quality Score199
Status Validated
Chromosome7
Chromosomal Location43463151-43472019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43465374 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 333 (A333V)
Ref Sequence ENSEMBL: ENSMUSP00000144692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107977] [ENSMUST00000203042] [ENSMUST00000203633] [ENSMUST00000203769] [ENSMUST00000204680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107977
AA Change: A435V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103611
Gene: ENSMUSG00000070604
AA Change: A435V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
IG 183 285 1.92e0 SMART
IG 298 383 2.15e-3 SMART
IGc2 406 465 4.19e-6 SMART
Blast:IG_like 582 649 1e-13 BLAST
transmembrane domain 764 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203152
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203769
AA Change: A333V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144692
Gene: ENSMUSG00000070604
AA Change: A333V

DomainStartEndE-ValueType
IG 81 183 8.1e-3 SMART
IG 196 281 9.2e-6 SMART
IGc2 304 363 1.8e-8 SMART
Blast:IG_like 480 547 9e-14 BLAST
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205247
Meta Mutation Damage Score 0.2199 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Vsig10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Vsig10l APN 7 43465254 missense probably damaging 1.00
IGL01390:Vsig10l APN 7 43466465 missense probably damaging 0.97
IGL02401:Vsig10l APN 7 43464044 missense probably damaging 1.00
IGL02404:Vsig10l APN 7 43463747 missense possibly damaging 0.85
IGL02514:Vsig10l APN 7 43463914 missense probably benign 0.02
IGL02636:Vsig10l APN 7 43463578 missense possibly damaging 0.53
IGL02805:Vsig10l APN 7 43465242 missense probably damaging 1.00
IGL02823:Vsig10l APN 7 43466464 missense probably damaging 1.00
IGL02827:Vsig10l APN 7 43464869 missense probably damaging 1.00
R0111:Vsig10l UTSW 7 43468101 missense probably damaging 0.97
R0394:Vsig10l UTSW 7 43465455 missense probably damaging 0.97
R0465:Vsig10l UTSW 7 43467442 missense probably damaging 1.00
R0632:Vsig10l UTSW 7 43464137 missense probably damaging 0.97
R1689:Vsig10l UTSW 7 43465368 missense possibly damaging 0.93
R1991:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2103:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2358:Vsig10l UTSW 7 43468761 missense probably benign 0.00
R3015:Vsig10l UTSW 7 43467457 missense possibly damaging 0.73
R4024:Vsig10l UTSW 7 43468086 missense probably benign 0.33
R4807:Vsig10l UTSW 7 43463749 missense possibly damaging 0.53
R5020:Vsig10l UTSW 7 43465317 nonsense probably null
R5261:Vsig10l UTSW 7 43470850 missense probably damaging 1.00
R5317:Vsig10l UTSW 7 43464823 missense probably damaging 1.00
R5426:Vsig10l UTSW 7 43464823 missense probably damaging 0.97
R5656:Vsig10l UTSW 7 43464151 nonsense probably null
R5842:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6012:Vsig10l UTSW 7 43468015 missense probably damaging 1.00
R6235:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6309:Vsig10l UTSW 7 43470973 utr 3 prime probably null
R6994:Vsig10l UTSW 7 43465067 missense possibly damaging 0.71
R7250:Vsig10l UTSW 7 43463675 missense probably benign
R7397:Vsig10l UTSW 7 43468007 missense probably damaging 1.00
R7767:Vsig10l UTSW 7 43463717 missense probably damaging 0.96
R8086:Vsig10l UTSW 7 43465452 missense possibly damaging 0.92
R8139:Vsig10l UTSW 7 43463729 missense probably benign 0.00
X0028:Vsig10l UTSW 7 43463364 utr 3 prime probably benign
X0067:Vsig10l UTSW 7 43467490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTTCTTTAACAGTCCAACCC -3'
(R):5'- TTTGCTGACACCCAGGACTC -3'

Sequencing Primer
(F):5'- TCCTGTCATTAGGGTCTCC -3'
(R):5'- TGACACCCAGGACTCCATGTG -3'
Posted On2015-04-30