Incidental Mutation 'R4031:Arl2bp'
ID313495
Institutional Source Beutler Lab
Gene Symbol Arl2bp
Ensembl Gene ENSMUSG00000031776
Gene NameADP-ribosylation factor-like 2 binding protein
Synonyms1700027H16Rik, Bart1, BART, 1700010P10Rik
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94666600-94674425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94667653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 32 (I32T)
Ref Sequence ENSEMBL: ENSMUSP00000148695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034228] [ENSMUST00000109527] [ENSMUST00000211858]
Predicted Effect probably damaging
Transcript: ENSMUST00000034228
AA Change: I32T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034228
Gene: ENSMUSG00000031776
AA Change: I32T

DomainStartEndE-ValueType
Pfam:ARL2_Bind_BART 20 134 3.8e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109527
AA Change: I21T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105153
Gene: ENSMUSG00000031776
AA Change: I21T

DomainStartEndE-ValueType
Pfam:ARL2_Bind_BART 5 125 1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211858
AA Change: I32T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212877
Meta Mutation Damage Score 0.7343 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. The protein encoded by this gene binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of this protein or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. This protein is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Arl2bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4955:Arl2bp UTSW 8 94670428 critical splice donor site probably null
R7071:Arl2bp UTSW 8 94667166 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGTGATGGGAGGATCATC -3'
(R):5'- GCATGCCCTTATAAGCAGAGG -3'

Sequencing Primer
(F):5'- TTTATGCACGTTGGGAATCTTAC -3'
(R):5'- AAAGTTGTCCTCTGAGCTCCACATAG -3'
Posted On2015-04-30