Incidental Mutation 'R4031:Aplp2'
ID313498
Institutional Source Beutler Lab
Gene Symbol Aplp2
Ensembl Gene ENSMUSG00000031996
Gene Nameamyloid beta (A4) precursor-like protein 2
Synonyms
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location31149557-31211815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31157730 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 601 (P601L)
Ref Sequence ENSEMBL: ENSMUSP00000072428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072634] [ENSMUST00000079758] [ENSMUST00000213254] [ENSMUST00000217641]
Predicted Effect probably benign
Transcript: ENSMUST00000072634
AA Change: P601L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072428
Gene: ENSMUSG00000031996
AA Change: P601L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
KU 308 361 3.52e-24 SMART
Pfam:APP_E2 365 547 1.6e-71 PFAM
low complexity region 555 568 N/A INTRINSIC
low complexity region 589 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Pfam:APP_amyloid 697 747 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079758
AA Change: P545L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078694
Gene: ENSMUSG00000031996
AA Change: P545L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
Pfam:APP_E2 307 492 2.3e-75 PFAM
low complexity region 499 512 N/A INTRINSIC
low complexity region 533 539 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:APP_amyloid 652 703 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213254
AA Change: P601L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217516
Predicted Effect probably benign
Transcript: ENSMUST00000217641
AA Change: P545L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217658
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for two different targeted alleles show embryonic lethality, or viability and fertility with increased copper levels in cerebral cortex and liver. Double knockouts with App show high mortality, reduced growth, and neurological symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Aplp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Aplp2 APN 9 31150895 missense probably damaging 1.00
IGL02152:Aplp2 APN 9 31211651 missense unknown
IGL02309:Aplp2 APN 9 31167683 missense possibly damaging 0.80
IGL02407:Aplp2 APN 9 31158527 nonsense probably null
IGL02623:Aplp2 APN 9 31178083 splice site probably benign
IGL02737:Aplp2 APN 9 31153416 missense probably benign
IGL02958:Aplp2 APN 9 31164676 splice site probably benign
R0211:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R0279:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R1669:Aplp2 UTSW 9 31167733 intron probably benign
R1707:Aplp2 UTSW 9 31150919 missense probably damaging 1.00
R1755:Aplp2 UTSW 9 31177104 missense probably damaging 1.00
R2512:Aplp2 UTSW 9 31167677 missense probably damaging 1.00
R2842:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R4115:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R5725:Aplp2 UTSW 9 31157814 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6375:Aplp2 UTSW 9 31157788 missense probably benign 0.00
R7170:Aplp2 UTSW 9 31170443 missense probably benign 0.03
R7541:Aplp2 UTSW 9 31152356 missense possibly damaging 0.82
R7584:Aplp2 UTSW 9 31157781 missense possibly damaging 0.56
R7711:Aplp2 UTSW 9 31161349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTTCCTCACAGAATCCAGC -3'
(R):5'- TCAAAGTACTGGTCCTGTGCC -3'

Sequencing Primer
(F):5'- GAATCCAGCACAGCACCTG -3'
(R):5'- AAAGTACTGGTCCTGTGCCTAGAC -3'
Posted On2015-04-30