Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Aplp2'

313498

Institutional Source

Beutler Lab

Gene Symbol

Aplp2

Ensembl Gene

ENSMUSG00000031996

Gene Name

amyloid beta (A4) precursor-like protein 2

Synonyms

MMRRC Submission

040960-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31149557-31211815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31157730 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 601 (P601L)

Ref Sequence

ENSEMBL: ENSMUSP00000072428 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072634] [ENSMUST00000079758] [ENSMUST00000213254] [ENSMUST00000217641]

Predicted Effect

probably benign
Transcript: ENSMUST00000072634
AA Change: P601L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000072428
Gene: ENSMUSG00000031996
AA Change: P601L

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
A4_EXTRA	42	204	7.91e-123	SMART
low complexity region	218	232	N/A	INTRINSIC
coiled coil region	242	269	N/A	INTRINSIC
KU	308	361	3.52e-24	SMART
Pfam:APP_E2	365	547	1.6e-71	PFAM
low complexity region	555	568	N/A	INTRINSIC
low complexity region	589	595	N/A	INTRINSIC
low complexity region	597	609	N/A	INTRINSIC
Pfam:APP_amyloid	697	747	1.5e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000079758
AA Change: P545L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000078694
Gene: ENSMUSG00000031996
AA Change: P545L

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
A4_EXTRA	42	204	7.91e-123	SMART
low complexity region	218	232	N/A	INTRINSIC
coiled coil region	242	269	N/A	INTRINSIC
Pfam:APP_E2	307	492	2.3e-75	PFAM
low complexity region	499	512	N/A	INTRINSIC
low complexity region	533	539	N/A	INTRINSIC
low complexity region	541	553	N/A	INTRINSIC
Pfam:APP_amyloid	652	703	1.5e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213254
AA Change: P601L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214396

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216921

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217516

Predicted Effect

probably benign
Transcript: ENSMUST00000217641
AA Change: P545L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217658

Meta Mutation Damage Score

0.1032

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for two different targeted alleles show embryonic lethality, or viability and fertility with increased copper levels in cerebral cortex and liver. Double knockouts with App show high mortality, reduced growth, and neurological symptoms. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Acss2	C	T	2: 155,557,210	T477I	probably damaging	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Copa	T	C	1: 172,108,375	V428A	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Elf1	A	C	14: 79,569,283	K161Q	probably damaging	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hyal4	A	G	6: 24,756,224	E147G	probably damaging	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Aplp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02067:Aplp2	APN	9	31150895	missense	probably damaging	1.00
IGL02152:Aplp2	APN	9	31211651	missense	unknown
IGL02309:Aplp2	APN	9	31167683	missense	possibly damaging	0.80
IGL02407:Aplp2	APN	9	31158527	nonsense	probably null
IGL02623:Aplp2	APN	9	31178083	splice site	probably benign
IGL02737:Aplp2	APN	9	31153416	missense	probably benign
IGL02958:Aplp2	APN	9	31164676	splice site	probably benign
R0211:Aplp2	UTSW	9	31157790	missense	probably damaging	0.99
R0279:Aplp2	UTSW	9	31157790	missense	probably damaging	0.99
R1669:Aplp2	UTSW	9	31167733	intron	probably benign
R1707:Aplp2	UTSW	9	31150919	missense	probably damaging	1.00
R1755:Aplp2	UTSW	9	31177104	missense	probably damaging	1.00
R2512:Aplp2	UTSW	9	31167677	missense	probably damaging	1.00
R2842:Aplp2	UTSW	9	31157826	missense	probably benign	0.12
R4115:Aplp2	UTSW	9	31157826	missense	probably benign	0.12
R5725:Aplp2	UTSW	9	31157814	missense	probably damaging	1.00
R6032:Aplp2	UTSW	9	31150944	missense	probably damaging	1.00
R6032:Aplp2	UTSW	9	31150944	missense	probably damaging	1.00
R6375:Aplp2	UTSW	9	31157788	missense	probably benign	0.00
R7170:Aplp2	UTSW	9	31170443	missense	probably benign	0.03
R7541:Aplp2	UTSW	9	31152356	missense	possibly damaging	0.82
R7584:Aplp2	UTSW	9	31157781	missense	possibly damaging	0.56
R7711:Aplp2	UTSW	9	31161349	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACTTCCTCACAGAATCCAGC -3'
(R):5'- TCAAAGTACTGGTCCTGTGCC -3'

Sequencing Primer
(F):5'- GAATCCAGCACAGCACCTG -3'
(R):5'- AAAGTACTGGTCCTGTGCCTAGAC -3'

Posted On

2015-04-30