Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Chrna5'

313499

Institutional Source

Beutler Lab

Gene Symbol

Chrna5

Ensembl Gene

ENSMUSG00000035594

Gene Name

cholinergic receptor, nicotinic, alpha polypeptide 5

Synonyms

Acra-5, Acra5

MMRRC Submission

040960-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54980880-55007779 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54998086 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 61 (W61R)

Ref Sequence

ENSEMBL: ENSMUSP00000150942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093844
AA Change: W32R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: W32R

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	18	221	4.9e-72	PFAM
Pfam:Neur_chan_memb	228	352	1.9e-51	PFAM
Pfam:Neur_chan_memb	338	417	1.2e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213960
AA Change: W61R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216865

Predicted Effect

probably benign
Transcript: ENSMUST00000217408

Meta Mutation Damage Score

0.4695

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Acss2	C	T	2: 155,557,210	T477I	probably damaging	Het
Aplp2	G	A	9: 31,157,730	P601L	probably benign	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Copa	T	C	1: 172,108,375	V428A	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Elf1	A	C	14: 79,569,283	K161Q	probably damaging	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hyal4	A	G	6: 24,756,224	E147G	probably damaging	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Chrna5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01407:Chrna5	APN	9	55004399	missense	possibly damaging	0.61
IGL01503:Chrna5	APN	9	54998171	intron	probably benign
IGL01617:Chrna5	APN	9	55005013	missense	probably damaging	0.98
IGL01935:Chrna5	APN	9	55004843	missense	probably benign	0.01
IGL02613:Chrna5	APN	9	55006421	missense	probably damaging	0.99
IGL03248:Chrna5	APN	9	55004639	missense	probably damaging	1.00
IGL03412:Chrna5	APN	9	55004435	missense	probably damaging	1.00
R0712:Chrna5	UTSW	9	55004363	missense	probably damaging	1.00
R1619:Chrna5	UTSW	9	55004365	missense	probably benign	0.00
R1698:Chrna5	UTSW	9	55004642	missense	probably damaging	1.00
R1789:Chrna5	UTSW	9	55004651	missense	possibly damaging	0.94
R1800:Chrna5	UTSW	9	55004875	missense	probably damaging	0.99
R4028:Chrna5	UTSW	9	54998086	missense	probably damaging	1.00
R4030:Chrna5	UTSW	9	54998086	missense	probably damaging	1.00
R4201:Chrna5	UTSW	9	54998075	missense	probably benign	0.00
R4792:Chrna5	UTSW	9	55004701	missense	probably damaging	1.00
R5196:Chrna5	UTSW	9	55006519	missense	possibly damaging	0.91
R5718:Chrna5	UTSW	9	54998105	missense	probably benign	0.00
R5779:Chrna5	UTSW	9	54998104	missense	probably benign	0.35
R6254:Chrna5	UTSW	9	55006456	missense	probably benign	0.00
R6492:Chrna5	UTSW	9	54998063	missense	probably benign	0.11
R6887:Chrna5	UTSW	9	55005133	missense	probably benign	0.00
R6986:Chrna5	UTSW	9	55006457	missense	possibly damaging	0.83
R7056:Chrna5	UTSW	9	54981701	intron	probably benign
R7222:Chrna5	UTSW	9	54998063	missense	probably benign	0.11
R7384:Chrna5	UTSW	9	55004833	missense	probably damaging	1.00
R7572:Chrna5	UTSW	9	55006465	missense	probably damaging	1.00
R7653:Chrna5	UTSW	9	55002434	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGCCAGCCAATTTCAAAC -3'
(R):5'- TTGGTCACTCTGGCAACCTC -3'

Sequencing Primer
(F):5'- GCCAGCAAACTAATTCCT -3'
(R):5'- CTAGTGGCTAACTCACACCTGG -3'

Posted On

2015-04-30