Incidental Mutation 'R4031:Slc26a10'
ID313502
Institutional Source Beutler Lab
Gene Symbol Slc26a10
Ensembl Gene ENSMUSG00000040441
Gene Namesolute carrier family 26, member 10
Synonyms
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127171393-127180645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127178002 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 297 (V297A)
Ref Sequence ENSEMBL: ENSMUSP00000092904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218654] [ENSMUST00000222006] [ENSMUST00000222911]
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095270
AA Change: V297A

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441
AA Change: V297A

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Predicted Effect probably benign
Transcript: ENSMUST00000222911
AA Change: V289A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.2006 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Slc26a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Slc26a10 APN 10 127174177 splice site probably benign
IGL01657:Slc26a10 APN 10 127175034 missense probably damaging 1.00
R1202:Slc26a10 UTSW 10 127173348 missense probably damaging 0.99
R1844:Slc26a10 UTSW 10 127178410 missense probably damaging 0.97
R2423:Slc26a10 UTSW 10 127179737 critical splice acceptor site probably null
R4779:Slc26a10 UTSW 10 127173355 missense possibly damaging 0.73
R5405:Slc26a10 UTSW 10 127174995 missense probably benign 0.09
R5478:Slc26a10 UTSW 10 127173949 missense probably benign 0.05
R5657:Slc26a10 UTSW 10 127174964 intron probably benign
R5990:Slc26a10 UTSW 10 127178758 missense possibly damaging 0.81
R6681:Slc26a10 UTSW 10 127173661 missense possibly damaging 0.93
R7083:Slc26a10 UTSW 10 127177168 missense probably damaging 1.00
R7365:Slc26a10 UTSW 10 127176847 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCTCTGGAAAGATGCTTGG -3'
(R):5'- AAAGAGAGTTTTGCCCCGG -3'

Sequencing Primer
(F):5'- TGCTTGGAAAAGTACGCGTCAC -3'
(R):5'- AGAGTTTTGCCCCGGCCTAG -3'
Posted On2015-04-30