Incidental Mutation 'R4031:Elf1'
ID313508
Institutional Source Beutler Lab
Gene Symbol Elf1
Ensembl Gene ENSMUSG00000036461
Gene NameE74-like factor 1
SynonymsElf-1, mElf-1, p70
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4031 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79481194-79582494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 79569283 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 161 (K161Q)
Ref Sequence ENSEMBL: ENSMUSP00000153956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040131] [ENSMUST00000110835] [ENSMUST00000227192]
Predicted Effect probably damaging
Transcript: ENSMUST00000040131
AA Change: K198Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046515
Gene: ENSMUSG00000036461
AA Change: K198Q

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 111 1.5e-47 PFAM
low complexity region 172 185 N/A INTRINSIC
ETS 207 294 6.39e-52 SMART
low complexity region 299 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110835
AA Change: K198Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106459
Gene: ENSMUSG00000036461
AA Change: K198Q

DomainStartEndE-ValueType
Pfam:Elf-1_N 1 111 1.9e-47 PFAM
low complexity region 172 185 N/A INTRINSIC
ETS 207 294 6.39e-52 SMART
low complexity region 299 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227192
AA Change: K161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E26 transformation-specific related transcription factor. The encoded protein is primarily expressed in lymphoid cells and acts as both an enhancer and a repressor to regulate transcription of various genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene show no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Elf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Elf1 APN 14 79580349 missense possibly damaging 0.62
IGL02582:Elf1 APN 14 79536379 missense probably damaging 0.99
R0049:Elf1 UTSW 14 79565525 missense probably damaging 1.00
R1344:Elf1 UTSW 14 79560775 missense probably damaging 1.00
R1418:Elf1 UTSW 14 79560775 missense probably damaging 1.00
R1483:Elf1 UTSW 14 79580638 missense probably benign 0.00
R1557:Elf1 UTSW 14 79567180 missense possibly damaging 0.88
R2342:Elf1 UTSW 14 79565456 intron probably benign
R3151:Elf1 UTSW 14 79567315 critical splice donor site probably null
R3771:Elf1 UTSW 14 79567210 missense possibly damaging 0.73
R3772:Elf1 UTSW 14 79567210 missense possibly damaging 0.73
R3773:Elf1 UTSW 14 79567210 missense possibly damaging 0.73
R4783:Elf1 UTSW 14 79580743 missense probably benign 0.01
R4784:Elf1 UTSW 14 79580743 missense probably benign 0.01
R5012:Elf1 UTSW 14 79570734 missense probably damaging 1.00
R6088:Elf1 UTSW 14 79567261 missense probably benign
R6293:Elf1 UTSW 14 79560786 missense probably damaging 0.99
R6329:Elf1 UTSW 14 79573339 missense possibly damaging 0.62
R7000:Elf1 UTSW 14 79570768 missense probably damaging 1.00
R7140:Elf1 UTSW 14 79567270 missense probably benign 0.03
R7621:Elf1 UTSW 14 79570882 missense possibly damaging 0.80
R7641:Elf1 UTSW 14 79570723 missense probably damaging 1.00
R7812:Elf1 UTSW 14 79565558 missense probably damaging 1.00
R7839:Elf1 UTSW 14 79536415 missense probably benign 0.02
R7922:Elf1 UTSW 14 79536415 missense probably benign 0.02
X0028:Elf1 UTSW 14 79565578 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTGTGAGCTAGCCTACTTAGTGTG -3'
(R):5'- AAGGTAGTCAATGTGGTGCATG -3'

Sequencing Primer
(F):5'- TGAGAGACCAGTTTGTATGACCC -3'
(R):5'- ATGTGTGCGTCACCACAC -3'
Posted On2015-04-30