Mutagenetix > Incidental Mutations

Incidental Mutation 'R4031:Elf1'

313508

Institutional Source

Beutler Lab

Gene Symbol

Elf1

Ensembl Gene

ENSMUSG00000036461

Gene Name

E74-like factor 1

Synonyms

Elf-1, mElf-1, p70

MMRRC Submission

040960-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R4031 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79481194-79582494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 79569283 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 161 (K161Q)

Ref Sequence

ENSEMBL: ENSMUSP00000153956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040131] [ENSMUST00000110835] [ENSMUST00000227192]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040131
AA Change: K198Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046515
Gene: ENSMUSG00000036461
AA Change: K198Q

Domain	Start	End	E-Value	Type
Pfam:Elf-1_N	2	111	1.5e-47	PFAM
low complexity region	172	185	N/A	INTRINSIC
ETS	207	294	6.39e-52	SMART
low complexity region	299	322	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110835
AA Change: K198Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106459
Gene: ENSMUSG00000036461
AA Change: K198Q

Domain	Start	End	E-Value	Type
Pfam:Elf-1_N	1	111	1.9e-47	PFAM
low complexity region	172	185	N/A	INTRINSIC
ETS	207	294	6.39e-52	SMART
low complexity region	299	322	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000227192
AA Change: K161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E26 transformation-specific related transcription factor. The encoded protein is primarily expressed in lymphoid cells and acts as both an enhancer and a repressor to regulate transcription of various genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene show no obvious phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,517,448	F1025L	probably damaging	Het
Acss2	C	T	2: 155,557,210	T477I	probably damaging	Het
Aplp2	G	A	9: 31,157,730	P601L	probably benign	Het
Arl2bp	T	C	8: 94,667,653	I32T	probably damaging	Het
Avpi1	C	A	19: 42,124,741		probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccdc150	T	A	1: 54,278,811	M303K	probably benign	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Copa	T	C	1: 172,108,375	V428A	probably damaging	Het
Crybb3	A	G	5: 113,079,869	Y29H	probably damaging	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Disp2	T	C	2: 118,791,880	I1031T	probably benign	Het
Fndc1	A	T	17: 7,769,752	Y1159*	probably null	Het
Hspa12a	T	C	19: 58,800,857	N449S	probably benign	Het
Hyal4	A	G	6: 24,756,224	E147G	probably damaging	Het
Hydin	T	C	8: 110,610,047	I5152T	probably benign	Het
Ighv9-1	C	T	12: 114,094,224	A19T	probably benign	Het
Kcnt1	T	G	2: 25,916,048	S1216R	possibly damaging	Het
Kdm5d	T	A	Y: 916,910	V435E	probably damaging	Het
Klhl30	G	A	1: 91,361,157	R546H	probably benign	Het
Lrp1b	C	T	2: 40,702,848	G3753D	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Macf1	A	G	4: 123,381,312	L6303P	probably damaging	Het
Mblac2	T	C	13: 81,750,089	S195P	possibly damaging	Het
Mindy3	A	C	2: 12,401,083		probably null	Het
Neurod1	C	T	2: 79,454,026	D338N	probably benign	Het
Polr1e	A	T	4: 45,018,685	E5V	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Ppp2r2a	T	C	14: 67,028,976	S79G	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Rap1gds1	T	C	3: 139,050,592		probably benign	Het
Rsph10b	A	G	5: 143,985,668		probably null	Het
Slc26a10	A	G	10: 127,178,002	V297A	possibly damaging	Het
Slc26a5	T	C	5: 21,847,191	K47E	probably damaging	Het
Slurp1	T	C	15: 74,727,487	E58G	probably damaging	Het
Spo11	T	A	2: 172,986,832		probably benign	Het
Tm9sf4	T	C	2: 153,198,344		probably benign	Het
Trak1	T	C	9: 121,451,670	I272T	probably damaging	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Unc79	T	A	12: 103,072,759	S671T	possibly damaging	Het
Usp43	G	T	11: 67,913,833	A186D	probably damaging	Het
Vmn2r107	G	A	17: 20,375,221	V679I	probably benign	Het
Vsig10l	C	T	7: 43,465,374	A333V	probably damaging	Het
Vwa3a	G	A	7: 120,768,232		probably null	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Wnk1	T	C	6: 119,951,068	T1141A	probably damaging	Het
Zfp236	T	A	18: 82,624,465	E1052V	probably damaging	Het
Zfp317	A	T	9: 19,646,712	H163L	possibly damaging	Het
Zfp975	G	A	7: 42,662,953	Q79*	probably null	Het

Other mutations in Elf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Elf1	APN	14	79580349	missense	possibly damaging	0.62
IGL02582:Elf1	APN	14	79536379	missense	probably damaging	0.99
Elvis	UTSW	14	79570723	missense	probably damaging	1.00
presley	UTSW	14	79570734	missense	probably damaging	1.00
R0049:Elf1	UTSW	14	79565525	missense	probably damaging	1.00
R1344:Elf1	UTSW	14	79560775	missense	probably damaging	1.00
R1418:Elf1	UTSW	14	79560775	missense	probably damaging	1.00
R1483:Elf1	UTSW	14	79580638	missense	probably benign	0.00
R1557:Elf1	UTSW	14	79567180	missense	possibly damaging	0.88
R2342:Elf1	UTSW	14	79565456	intron	probably benign
R3151:Elf1	UTSW	14	79567315	critical splice donor site	probably null
R3771:Elf1	UTSW	14	79567210	missense	possibly damaging	0.73
R3772:Elf1	UTSW	14	79567210	missense	possibly damaging	0.73
R3773:Elf1	UTSW	14	79567210	missense	possibly damaging	0.73
R4783:Elf1	UTSW	14	79580743	missense	probably benign	0.01
R4784:Elf1	UTSW	14	79580743	missense	probably benign	0.01
R5012:Elf1	UTSW	14	79570734	missense	probably damaging	1.00
R6088:Elf1	UTSW	14	79567261	missense	probably benign
R6293:Elf1	UTSW	14	79560786	missense	probably damaging	0.99
R6329:Elf1	UTSW	14	79573339	missense	possibly damaging	0.62
R7000:Elf1	UTSW	14	79570768	missense	probably damaging	1.00
R7140:Elf1	UTSW	14	79567270	missense	probably benign	0.03
R7621:Elf1	UTSW	14	79570882	missense	possibly damaging	0.80
R7641:Elf1	UTSW	14	79570723	missense	probably damaging	1.00
R7812:Elf1	UTSW	14	79565558	missense	probably damaging	1.00
R7839:Elf1	UTSW	14	79536415	missense	probably benign	0.02
R7919:Elf1	UTSW	14	79560899	missense	probably benign	0.00
R8068:Elf1	UTSW	14	79536390	missense	probably benign	0.04
R8253:Elf1	UTSW	14	79536352	start codon destroyed	probably null	0.68
X0028:Elf1	UTSW	14	79565578	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGTGAGCTAGCCTACTTAGTGTG -3'
(R):5'- AAGGTAGTCAATGTGGTGCATG -3'

Sequencing Primer
(F):5'- TGAGAGACCAGTTTGTATGACCC -3'
(R):5'- ATGTGTGCGTCACCACAC -3'

Posted On

2015-04-30