Incidental Mutation 'R4031:Vmn2r107'
ID313512
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Namevomeronasal 2, receptor 107
SynonymsV2r6
MMRRC Submission 040960-MU
Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4031 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20345425-20375772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20375221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 679 (V679I)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
Predicted Effect probably benign
Transcript: ENSMUST00000042090
AA Change: V679I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: V679I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp236 T A 18: 82,624,465 E1052V probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20375747 missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20345606 missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20357800 missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20374906 missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20356777 missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20375561 missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20356744 missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20357755 missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20375712 missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20356911 missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20356776 missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20357958 splice site probably benign
3-1:Vmn2r107 UTSW 17 20345504 missense probably benign
R0285:Vmn2r107 UTSW 17 20345611 missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20374823 splice site probably benign
R0497:Vmn2r107 UTSW 17 20375132 missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20357759 missense probably benign
R0621:Vmn2r107 UTSW 17 20374990 missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20355654 missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20356598 missense probably benign 0.03
R1204:Vmn2r107 UTSW 17 20357769 missense probably benign
R1237:Vmn2r107 UTSW 17 20356685 nonsense probably null
R1485:Vmn2r107 UTSW 17 20374847 missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20356513 missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20345578 missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20355617 splice site probably null
R2009:Vmn2r107 UTSW 17 20375467 missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20375287 missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20375642 missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20375555 missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20360345 missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20374889 missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20375455 missense probably damaging 1.00
R4270:Vmn2r107 UTSW 17 20355779 missense probably benign
R4963:Vmn2r107 UTSW 17 20375141 missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20355753 missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20375164 missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20375054 missense probably benign 0.19
R6238:Vmn2r107 UTSW 17 20345587 missense probably benign 0.43
R6298:Vmn2r107 UTSW 17 20355782 missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20375677 missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20375375 missense probably damaging 0.96
R6782:Vmn2r107 UTSW 17 20356879 missense probably damaging 1.00
R7299:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7301:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7375:Vmn2r107 UTSW 17 20355876 missense probably benign
R7448:Vmn2r107 UTSW 17 20375732 missense probably benign 0.00
R7495:Vmn2r107 UTSW 17 20375009 missense possibly damaging 0.71
R7589:Vmn2r107 UTSW 17 20375372 missense probably benign 0.05
R7594:Vmn2r107 UTSW 17 20360373 missense probably benign 0.03
R7678:Vmn2r107 UTSW 17 20356639 missense probably benign 0.01
R8040:Vmn2r107 UTSW 17 20375546 missense not run
X0022:Vmn2r107 UTSW 17 20356968 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AATCAAGCTCTGAGTTACACTTTGC -3'
(R):5'- AGGTATCCCAGGACAGAGTG -3'

Sequencing Primer
(F):5'- GAGTTACACTTTGCTCATCACAC -3'
(R):5'- CTGAGCCCTTGTTGCACAAAATG -3'
Posted On2015-04-30