Incidental Mutation 'R4032:Cry2'
ID 313521
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Name cryptochrome circadian regulator 2
Synonyms D130054K12Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R4032 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 92233991-92264388 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92244172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 334 (I334V)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
AlphaFold Q9R194
Predicted Effect probably benign
Transcript: ENSMUST00000090559
AA Change: I334V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: I334V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111278
AA Change: I334V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: I334V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126002
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Arhgap17 G T 7: 122,879,289 (GRCm39) probably benign Het
Atp13a4 T A 16: 29,237,389 (GRCm39) M846L probably damaging Het
Capn5 G T 7: 97,778,453 (GRCm39) Q389K probably damaging Het
Cdkl3 T A 11: 51,902,118 (GRCm39) I109N probably damaging Het
Cs T C 10: 128,196,913 (GRCm39) L436P probably damaging Het
D17H6S53E T C 17: 35,346,355 (GRCm39) S89P probably benign Het
Dync1h1 C T 12: 110,584,483 (GRCm39) Q629* probably null Het
H4c12 T C 13: 21,934,588 (GRCm39) I30V possibly damaging Het
Itpka C T 2: 119,573,082 (GRCm39) P75S probably benign Het
Lyst C T 13: 13,791,250 (GRCm39) H38Y probably damaging Het
Mansc4 T C 6: 146,976,678 (GRCm39) K313E probably benign Het
Megf6 T A 4: 154,261,550 (GRCm39) C58* probably null Het
Mtor T C 4: 148,621,209 (GRCm39) V1869A probably benign Het
Mybpc1 T C 10: 88,365,426 (GRCm39) D899G probably benign Het
Nek10 C A 14: 14,853,877 (GRCm38) probably null Het
Nfkb1 T C 3: 135,300,110 (GRCm39) S657G possibly damaging Het
Or10d5j T C 9: 39,867,629 (GRCm39) T213A probably benign Het
Or2a25 A T 6: 42,888,559 (GRCm39) Y34F probably benign Het
Or4m1 T A 14: 50,557,767 (GRCm39) D175V possibly damaging Het
Or4n5 G T 14: 50,132,433 (GRCm39) H275Q probably benign Het
Or51f23 A G 7: 102,453,396 (GRCm39) K237R probably benign Het
Pabir1 C T 19: 24,454,106 (GRCm39) M205I probably benign Het
Pde1b A G 15: 103,429,753 (GRCm39) D82G probably damaging Het
Pdzrn4 C T 15: 92,667,414 (GRCm39) T522M probably damaging Het
Ptpro C A 6: 137,438,740 (GRCm39) N373K probably damaging Het
Ptprs T C 17: 56,720,386 (GRCm39) Y1478C probably damaging Het
Sdc2 A T 15: 33,017,323 (GRCm39) I46F probably damaging Het
Sergef C A 7: 46,092,726 (GRCm39) E428* probably null Het
Stk36 A G 1: 74,665,207 (GRCm39) S651G probably benign Het
Ubr5 A G 15: 38,025,081 (GRCm39) V559A Het
Ugt8a C A 3: 125,667,807 (GRCm39) D345Y probably damaging Het
Usp44 A G 10: 93,683,127 (GRCm39) probably benign Het
Vps13a A T 19: 16,594,263 (GRCm39) L3156Q probably damaging Het
Zfp655 A G 5: 145,180,858 (GRCm39) T239A possibly damaging Het
Zfp87 T C 13: 74,520,449 (GRCm39) T210A possibly damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92,254,977 (GRCm39) missense probably benign 0.15
IGL02167:Cry2 APN 2 92,264,166 (GRCm39) missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92,243,384 (GRCm39) missense probably damaging 0.99
IGL02343:Cry2 APN 2 92,257,266 (GRCm39) missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92,244,012 (GRCm39) missense probably damaging 0.99
IGL02725:Cry2 APN 2 92,243,605 (GRCm39) splice site probably benign
IGL02932:Cry2 APN 2 92,243,462 (GRCm39) nonsense probably null
IGL03122:Cry2 APN 2 92,243,640 (GRCm39) missense probably damaging 1.00
IGL03366:Cry2 APN 2 92,244,060 (GRCm39) missense probably damaging 1.00
R0679:Cry2 UTSW 2 92,244,060 (GRCm39) missense probably damaging 1.00
R1325:Cry2 UTSW 2 92,244,115 (GRCm39) missense probably damaging 1.00
R1862:Cry2 UTSW 2 92,254,911 (GRCm39) missense probably damaging 1.00
R1891:Cry2 UTSW 2 92,243,985 (GRCm39) missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92,242,037 (GRCm39) missense possibly damaging 0.84
R4689:Cry2 UTSW 2 92,254,899 (GRCm39) missense probably benign 0.38
R5130:Cry2 UTSW 2 92,254,944 (GRCm39) missense probably benign 0.28
R5145:Cry2 UTSW 2 92,243,405 (GRCm39) missense probably benign
R5970:Cry2 UTSW 2 92,243,312 (GRCm39) missense probably benign 0.08
R6179:Cry2 UTSW 2 92,244,187 (GRCm39) missense probably damaging 0.98
R7102:Cry2 UTSW 2 92,243,438 (GRCm39) missense probably damaging 0.99
R7158:Cry2 UTSW 2 92,244,060 (GRCm39) missense probably damaging 1.00
R7213:Cry2 UTSW 2 92,244,004 (GRCm39) missense probably benign 0.00
R7257:Cry2 UTSW 2 92,243,326 (GRCm39) missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92,244,009 (GRCm39) missense probably damaging 1.00
R7427:Cry2 UTSW 2 92,243,392 (GRCm39) missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92,243,392 (GRCm39) missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92,243,983 (GRCm39) missense probably damaging 1.00
R7531:Cry2 UTSW 2 92,243,350 (GRCm39) missense probably damaging 0.98
R8234:Cry2 UTSW 2 92,242,974 (GRCm39) missense probably benign
R8350:Cry2 UTSW 2 92,244,286 (GRCm39) missense probably benign 0.00
R8450:Cry2 UTSW 2 92,244,286 (GRCm39) missense probably benign 0.00
R8496:Cry2 UTSW 2 92,257,284 (GRCm39) missense probably damaging 1.00
R9172:Cry2 UTSW 2 92,243,993 (GRCm39) missense probably damaging 1.00
R9283:Cry2 UTSW 2 92,244,249 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGTACAGGCTAGCTTG -3'
(R):5'- ATCGTCACAGTGCTAAGAGC -3'

Sequencing Primer
(F):5'- GTACAGGCTAGCTTGCACTCAC -3'
(R):5'- CCAGGCAGACACTCATCTCTGTG -3'
Posted On 2015-04-30