Incidental Mutation 'R4032:Nfkb1'
ID313524
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonymsp50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4032 (G1)
Quality Score163
Status Not validated
Chromosome3
Chromosomal Location135584655-135691547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135594349 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 657 (S657G)
Ref Sequence ENSEMBL: ENSMUSP00000128345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
PDB Structure
STRUCTURE OF NF-KB P50 HOMODIMER BOUND TO A KB SITE [X-RAY DIFFRACTION]
IKAPPABALPHA/NF-KAPPAB COMPLEX [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
STRUCTURE OF THE NUCLEAR FACTOR KAPPA-B (NF-KB) P50 HOMODIMER [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF NF-kB(p50)2 COMPLEXED TO A HIGH-AFFINITY RNA APTAMER [X-RAY DIFFRACTION]
Crystal stucture of WLAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of MLAV mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of ILAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
>> 7 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000029812
AA Change: S657G

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: S657G

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129428
Predicted Effect unknown
Transcript: ENSMUST00000132668
AA Change: S296G
SMART Domains Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163
AA Change: S296G

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
Blast:IPT 55 156 4e-22 BLAST
ANK 178 208 2.27e1 SMART
ANK 217 246 1.11e-2 SMART
ANK 250 280 2.47e0 SMART
ANK 286 315 5.53e-3 SMART
ANK 320 350 1.9e-1 SMART
ANK 354 383 2.18e-1 SMART
Blast:DEATH 441 505 1e-34 BLAST
PDB:2DBF|A 442 505 5e-32 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150007
Predicted Effect possibly damaging
Transcript: ENSMUST00000164430
AA Change: S657G

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: S657G

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184550
AA Change: S145G
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Fam122a C T 19: 24,476,742 M205I probably benign Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr564 A G 7: 102,804,189 K237R probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pde1b A G 15: 103,521,326 D82G probably damaging Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sdc2 A T 15: 33,017,177 I46F probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A probably benign Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Usp44 A G 10: 93,847,265 probably benign Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp655 A G 5: 145,244,048 T239A possibly damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Conversely UTSW 3 135626659 missense probably damaging 1.00
Finlay UTSW 3 135595053 nonsense probably null
Frisbee UTSW 3 135613943 missense possibly damaging 0.93
kookaburra UTSW 3 135626611 nonsense probably null
Murgatroyd UTSW 3 135626710 missense possibly damaging 0.72
Poderoso UTSW 3 135613990 missense probably damaging 1.00
Puff UTSW 3 135595053 nonsense probably null
Roomba UTSW 3 135612412 critical splice donor site probably null
Wheelo UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
R7175:Nfkb1 UTSW 3 135613990 missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135626659 missense probably damaging 1.00
R7394:Nfkb1 UTSW 3 135613697 missense possibly damaging 0.54
R7727:Nfkb1 UTSW 3 135585401 missense possibly damaging 0.48
R7815:Nfkb1 UTSW 3 135603791 missense probably damaging 1.00
R7849:Nfkb1 UTSW 3 135585412 missense
R7932:Nfkb1 UTSW 3 135585412 missense
R8059:Nfkb1 UTSW 3 135593852 missense possibly damaging 0.54
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGCCCTAGAGTCATTC -3'
(R):5'- GGCTTCTGAAAGTAGAACAGTG -3'

Sequencing Primer
(F):5'- CCCTAAAACTTCCAGGGGGATTTAG -3'
(R):5'- TTCTGAAAGTAGAACAGTGGACCGTC -3'
Posted On2015-04-30