Incidental Mutation 'R4032:Zfp655'
ID313529
Institutional Source Beutler Lab
Gene Symbol Zfp655
Ensembl Gene ENSMUSG00000007812
Gene Namezinc finger protein 655
Synonyms9030409O18Rik, 2700038I16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R4032 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145231715-145247302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145244048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 239 (T239A)
Ref Sequence ENSEMBL: ENSMUSP00000128969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167316] [ENSMUST00000199322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167316
AA Change: T239A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812
AA Change: T239A

DomainStartEndE-ValueType
ZnF_C2H2 243 265 5.29e-5 SMART
ZnF_C2H2 271 293 2.99e-4 SMART
ZnF_C2H2 299 328 1.38e2 SMART
ZnF_C2H2 334 356 6.78e-3 SMART
ZnF_C2H2 361 383 3.99e0 SMART
ZnF_C2H2 411 433 3.63e-3 SMART
ZnF_C2H2 439 461 1.01e-1 SMART
low complexity region 463 475 N/A INTRINSIC
ZnF_C2H2 495 517 6.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199322
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Fam122a C T 19: 24,476,742 M205I probably benign Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Nfkb1 T C 3: 135,594,349 S657G possibly damaging Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr564 A G 7: 102,804,189 K237R probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pde1b A G 15: 103,521,326 D82G probably damaging Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sdc2 A T 15: 33,017,177 I46F probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Usp44 A G 10: 93,847,265 probably benign Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Zfp655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Zfp655 APN 5 145244145 missense probably damaging 1.00
IGL01679:Zfp655 APN 5 145243827 missense probably damaging 0.96
IGL02379:Zfp655 APN 5 145243955 missense probably benign 0.13
IGL02647:Zfp655 APN 5 145243006 missense probably benign
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0270:Zfp655 UTSW 5 145244457 missense probably damaging 1.00
R0608:Zfp655 UTSW 5 145244057 missense possibly damaging 0.57
R1528:Zfp655 UTSW 5 145244601 missense probably damaging 0.98
R2076:Zfp655 UTSW 5 145244600 missense possibly damaging 0.89
R2119:Zfp655 UTSW 5 145244784 missense probably damaging 0.98
R2375:Zfp655 UTSW 5 145244396 missense probably benign 0.10
R2403:Zfp655 UTSW 5 145244546 missense probably benign 0.00
R4532:Zfp655 UTSW 5 145244697 missense probably benign 0.06
R4880:Zfp655 UTSW 5 145244358 missense probably damaging 0.99
R5484:Zfp655 UTSW 5 145243635 missense probably benign 0.01
R5529:Zfp655 UTSW 5 145244736 missense probably damaging 0.96
R6193:Zfp655 UTSW 5 145244776 missense probably benign 0.03
R6195:Zfp655 UTSW 5 145243762 missense possibly damaging 0.52
R7050:Zfp655 UTSW 5 145244735 missense probably benign 0.12
R7471:Zfp655 UTSW 5 145244732 missense possibly damaging 0.80
R7612:Zfp655 UTSW 5 145237189 missense unknown
R7626:Zfp655 UTSW 5 145237107 missense probably damaging 1.00
R7989:Zfp655 UTSW 5 145244570 missense probably damaging 1.00
R8557:Zfp655 UTSW 5 145244025 missense probably benign 0.37
R8805:Zfp655 UTSW 5 145244480 missense probably damaging 1.00
Z1176:Zfp655 UTSW 5 145244003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCACACTTGATACAGATCAGAG -3'
(R):5'- CATCACAGGACTTATCAGACGC -3'

Sequencing Primer
(F):5'- CACACTTGATACAGATCAGAGAGTTC -3'
(R):5'- CAGACGCTTCACATTTGTAGG -3'
Posted On2015-04-30