Incidental Mutation 'R4032:Olfr564'
ID313535
Institutional Source Beutler Lab
Gene Symbol Olfr564
Ensembl Gene ENSMUSG00000048469
Gene Nameolfactory receptor 564
SynonymsGA_x6K02T2PBJ9-5513635-5514627, MOR14-10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4032 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102803480-102804430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102804189 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 237 (K237R)
Ref Sequence ENSEMBL: ENSMUSP00000129376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061096]
Predicted Effect probably benign
Transcript: ENSMUST00000061096
AA Change: K237R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129376
Gene: ENSMUSG00000048469
AA Change: K237R

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-117 PFAM
Pfam:7TM_GPCR_Srsx 38 256 4.7e-8 PFAM
Pfam:7tm_1 43 294 2.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Fam122a C T 19: 24,476,742 M205I probably benign Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Nfkb1 T C 3: 135,594,349 S657G possibly damaging Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pde1b A G 15: 103,521,326 D82G probably damaging Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sdc2 A T 15: 33,017,177 I46F probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A probably benign Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Usp44 A G 10: 93,847,265 probably benign Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp655 A G 5: 145,244,048 T239A possibly damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Olfr564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Olfr564 APN 7 102803854 nonsense probably null
IGL03248:Olfr564 APN 7 102803639 nonsense probably null
R1108:Olfr564 UTSW 7 102803850 missense probably benign 0.08
R1395:Olfr564 UTSW 7 102804207 missense possibly damaging 0.90
R1422:Olfr564 UTSW 7 102803850 missense probably benign 0.08
R5168:Olfr564 UTSW 7 102804321 missense probably benign
R5269:Olfr564 UTSW 7 102804120 missense probably benign
R5639:Olfr564 UTSW 7 102803993 missense probably benign
R5930:Olfr564 UTSW 7 102804274 missense probably damaging 1.00
R6019:Olfr564 UTSW 7 102804284 nonsense probably null
R7206:Olfr564 UTSW 7 102803684 missense probably damaging 1.00
R7254:Olfr564 UTSW 7 102803558 missense probably benign
R7845:Olfr564 UTSW 7 102804285 missense not run
R7928:Olfr564 UTSW 7 102804285 missense not run
R8036:Olfr564 UTSW 7 102803556 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTACTGTAGCAGCCATGTGC -3'
(R):5'- ACTTTCAACACAGCCTTCCG -3'

Sequencing Primer
(F):5'- ATGTGCTTCATCACTCCTACTG -3'
(R):5'- CTTCACACTGTAGATGATGGGG -3'
Posted On2015-04-30