Incidental Mutation 'R4032:Dync1h1'
ID 313547
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Name dynein cytoplasmic 1 heavy chain 1
Synonyms MAP1C, Loa, Dnec1, Dnchc1, dynein heavy chain, retrograde transport, 9930018I23Rik, Swl
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4032 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 110567886-110633379 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 110584483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 629 (Q629*)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
AlphaFold no structure available at present
PDB Structure Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000018851
AA Change: Q629*
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: Q629*

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Arhgap17 G T 7: 122,879,289 (GRCm39) probably benign Het
Atp13a4 T A 16: 29,237,389 (GRCm39) M846L probably damaging Het
Capn5 G T 7: 97,778,453 (GRCm39) Q389K probably damaging Het
Cdkl3 T A 11: 51,902,118 (GRCm39) I109N probably damaging Het
Cry2 T C 2: 92,244,172 (GRCm39) I334V probably benign Het
Cs T C 10: 128,196,913 (GRCm39) L436P probably damaging Het
D17H6S53E T C 17: 35,346,355 (GRCm39) S89P probably benign Het
H4c12 T C 13: 21,934,588 (GRCm39) I30V possibly damaging Het
Itpka C T 2: 119,573,082 (GRCm39) P75S probably benign Het
Lyst C T 13: 13,791,250 (GRCm39) H38Y probably damaging Het
Mansc4 T C 6: 146,976,678 (GRCm39) K313E probably benign Het
Megf6 T A 4: 154,261,550 (GRCm39) C58* probably null Het
Mtor T C 4: 148,621,209 (GRCm39) V1869A probably benign Het
Mybpc1 T C 10: 88,365,426 (GRCm39) D899G probably benign Het
Nek10 C A 14: 14,853,877 (GRCm38) probably null Het
Nfkb1 T C 3: 135,300,110 (GRCm39) S657G possibly damaging Het
Or10d5j T C 9: 39,867,629 (GRCm39) T213A probably benign Het
Or2a25 A T 6: 42,888,559 (GRCm39) Y34F probably benign Het
Or4m1 T A 14: 50,557,767 (GRCm39) D175V possibly damaging Het
Or4n5 G T 14: 50,132,433 (GRCm39) H275Q probably benign Het
Or51f23 A G 7: 102,453,396 (GRCm39) K237R probably benign Het
Pabir1 C T 19: 24,454,106 (GRCm39) M205I probably benign Het
Pde1b A G 15: 103,429,753 (GRCm39) D82G probably damaging Het
Pdzrn4 C T 15: 92,667,414 (GRCm39) T522M probably damaging Het
Ptpro C A 6: 137,438,740 (GRCm39) N373K probably damaging Het
Ptprs T C 17: 56,720,386 (GRCm39) Y1478C probably damaging Het
Sdc2 A T 15: 33,017,323 (GRCm39) I46F probably damaging Het
Sergef C A 7: 46,092,726 (GRCm39) E428* probably null Het
Stk36 A G 1: 74,665,207 (GRCm39) S651G probably benign Het
Ubr5 A G 15: 38,025,081 (GRCm39) V559A Het
Ugt8a C A 3: 125,667,807 (GRCm39) D345Y probably damaging Het
Usp44 A G 10: 93,683,127 (GRCm39) probably benign Het
Vps13a A T 19: 16,594,263 (GRCm39) L3156Q probably damaging Het
Zfp655 A G 5: 145,180,858 (GRCm39) T239A possibly damaging Het
Zfp87 T C 13: 74,520,449 (GRCm39) T210A possibly damaging Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110,615,538 (GRCm39) missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110,580,541 (GRCm39) missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110,592,041 (GRCm39) splice site probably benign
IGL01324:Dync1h1 APN 12 110,593,299 (GRCm39) missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110,583,126 (GRCm39) splice site probably benign
IGL01371:Dync1h1 APN 12 110,605,285 (GRCm39) missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110,624,562 (GRCm39) missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110,581,374 (GRCm39) missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110,625,364 (GRCm39) missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110,618,630 (GRCm39) critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110,603,558 (GRCm39) missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110,599,254 (GRCm39) missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110,628,993 (GRCm39) missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110,629,436 (GRCm39) missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110,607,322 (GRCm39) missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110,606,644 (GRCm39) missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110,625,666 (GRCm39) nonsense probably null
IGL02643:Dync1h1 APN 12 110,625,706 (GRCm39) unclassified probably benign
IGL03076:Dync1h1 APN 12 110,624,327 (GRCm39) missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110,632,989 (GRCm39) splice site probably null
IGL03293:Dync1h1 APN 12 110,595,168 (GRCm39) missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110,585,644 (GRCm39) missense possibly damaging 0.49
chinashop UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
Gesund UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
gymnast UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
Lightfoot UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
Lissom UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
Strong UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
waters UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110,615,538 (GRCm39) missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110,583,241 (GRCm39) missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110,602,880 (GRCm39) missense probably benign
R0110:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110,585,108 (GRCm39) missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110,598,126 (GRCm39) missense probably benign
R0450:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110,599,222 (GRCm39) missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110,582,930 (GRCm39) missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110,618,181 (GRCm39) unclassified probably benign
R0685:Dync1h1 UTSW 12 110,623,626 (GRCm39) missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110,595,718 (GRCm39) missense probably damaging 0.99
R0747:Dync1h1 UTSW 12 110,578,845 (GRCm39) missense probably benign
R0843:Dync1h1 UTSW 12 110,631,647 (GRCm39) missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110,632,393 (GRCm39) missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110,615,698 (GRCm39) missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110,622,791 (GRCm39) missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110,632,096 (GRCm39) critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110,593,426 (GRCm39) missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110,599,362 (GRCm39) splice site probably benign
R1812:Dync1h1 UTSW 12 110,629,334 (GRCm39) missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110,629,059 (GRCm39) missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110,591,070 (GRCm39) missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110,612,738 (GRCm39) missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110,629,063 (GRCm39) missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110,592,166 (GRCm39) missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110,632,857 (GRCm39) critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110,581,026 (GRCm39) missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110,616,022 (GRCm39) missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110,596,420 (GRCm39) missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110,607,316 (GRCm39) missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110,623,065 (GRCm39) missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110,607,654 (GRCm39) missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110,609,681 (GRCm39) missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110,583,325 (GRCm39) missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110,607,460 (GRCm39) critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110,607,020 (GRCm39) missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110,609,563 (GRCm39) missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3736:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3882:Dync1h1 UTSW 12 110,595,492 (GRCm39) missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110,632,399 (GRCm39) missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110,609,624 (GRCm39) missense probably damaging 1.00
R4355:Dync1h1 UTSW 12 110,599,333 (GRCm39) missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110,623,573 (GRCm39) missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110,615,917 (GRCm39) missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110,605,278 (GRCm39) missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110,595,201 (GRCm39) missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110,628,975 (GRCm39) missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110,621,962 (GRCm39) missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4733:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4780:Dync1h1 UTSW 12 110,627,630 (GRCm39) missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110,606,235 (GRCm39) missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110,629,289 (GRCm39) missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110,584,444 (GRCm39) missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110,593,326 (GRCm39) nonsense probably null
R5036:Dync1h1 UTSW 12 110,596,969 (GRCm39) missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110,607,341 (GRCm39) missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110,584,366 (GRCm39) missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110,596,114 (GRCm39) missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110,595,264 (GRCm39) missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110,581,502 (GRCm39) missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110,599,099 (GRCm39) missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110,627,384 (GRCm39) missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110,607,575 (GRCm39) missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110,632,422 (GRCm39) missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110,595,496 (GRCm39) missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110,612,707 (GRCm39) nonsense probably null
R5806:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110,580,654 (GRCm39) critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110,599,212 (GRCm39) missense probably benign
R6113:Dync1h1 UTSW 12 110,586,848 (GRCm39) missense probably benign
R6119:Dync1h1 UTSW 12 110,594,440 (GRCm39) missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110,584,427 (GRCm39) missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110,612,639 (GRCm39) missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110,583,171 (GRCm39) missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110,616,282 (GRCm39) missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110,624,981 (GRCm39) missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110,618,614 (GRCm39) missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110,590,995 (GRCm39) missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110,605,335 (GRCm39) missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110,632,521 (GRCm39) nonsense probably null
R7096:Dync1h1 UTSW 12 110,623,512 (GRCm39) missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110,568,173 (GRCm39) missense probably benign
R7224:Dync1h1 UTSW 12 110,584,196 (GRCm39) missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110,631,183 (GRCm39) critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110,631,596 (GRCm39) missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110,602,076 (GRCm39) missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110,591,036 (GRCm39) missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110,600,654 (GRCm39) missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110,632,109 (GRCm39) missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110,618,011 (GRCm39) missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110,580,541 (GRCm39) missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110,597,059 (GRCm39) missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110,627,327 (GRCm39) missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110,585,080 (GRCm39) missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110,632,200 (GRCm39) missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110,621,893 (GRCm39) missense possibly damaging 0.53
R7891:Dync1h1 UTSW 12 110,609,590 (GRCm39) missense probably benign 0.02
R7895:Dync1h1 UTSW 12 110,582,891 (GRCm39) missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110,595,168 (GRCm39) missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110,582,794 (GRCm39) missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110,602,908 (GRCm39) missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110,632,226 (GRCm39) missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110,584,576 (GRCm39) missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110,583,177 (GRCm39) missense possibly damaging 0.94
R8731:Dync1h1 UTSW 12 110,607,018 (GRCm39) missense possibly damaging 0.93
R8739:Dync1h1 UTSW 12 110,581,014 (GRCm39) missense probably damaging 1.00
R8756:Dync1h1 UTSW 12 110,583,261 (GRCm39) missense probably benign 0.06
R8855:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8866:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8885:Dync1h1 UTSW 12 110,583,172 (GRCm39) missense probably damaging 1.00
R8893:Dync1h1 UTSW 12 110,608,477 (GRCm39) missense probably damaging 1.00
R8913:Dync1h1 UTSW 12 110,624,602 (GRCm39) missense probably benign 0.14
R8937:Dync1h1 UTSW 12 110,584,471 (GRCm39) missense probably damaging 1.00
R8958:Dync1h1 UTSW 12 110,586,805 (GRCm39) missense probably benign 0.00
R9000:Dync1h1 UTSW 12 110,606,397 (GRCm39) missense probably benign
R9036:Dync1h1 UTSW 12 110,606,186 (GRCm39) missense probably benign
R9090:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9108:Dync1h1 UTSW 12 110,622,706 (GRCm39) intron probably benign
R9161:Dync1h1 UTSW 12 110,625,023 (GRCm39) missense probably benign 0.01
R9185:Dync1h1 UTSW 12 110,601,937 (GRCm39) missense probably benign 0.33
R9271:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9436:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9478:Dync1h1 UTSW 12 110,625,137 (GRCm39) missense probably benign 0.02
R9547:Dync1h1 UTSW 12 110,624,805 (GRCm39) missense probably damaging 1.00
R9561:Dync1h1 UTSW 12 110,615,533 (GRCm39) missense probably damaging 0.99
R9586:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9609:Dync1h1 UTSW 12 110,607,362 (GRCm39) missense probably benign 0.01
Z1088:Dync1h1 UTSW 12 110,596,351 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,624,951 (GRCm39) nonsense probably null
Z1177:Dync1h1 UTSW 12 110,607,611 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,603,988 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGAGGATCGACCGTGTG -3'
(R):5'- CATTCGGAAGCTGTCTCCATCC -3'

Sequencing Primer
(F):5'- ATCGACCGTGTGGAGACC -3'
(R):5'- AAGCTGTCTCCATCCTGCTTCAG -3'
Posted On 2015-04-30