Incidental Mutation 'R4032:Sdc2'
ID313554
Institutional Source Beutler Lab
Gene Symbol Sdc2
Ensembl Gene ENSMUSG00000022261
Gene Namesyndecan 2
Synonyms4833414L08Rik, Hspg1, Synd2, fibroglycan
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4032 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location32920723-33034935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33017177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 46 (I46F)
Ref Sequence ENSEMBL: ENSMUSP00000022871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022871]
Predicted Effect probably damaging
Transcript: ENSMUST00000022871
AA Change: I46F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022871
Gene: ENSMUSG00000022261
AA Change: I46F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
4.1m 169 187 3.69e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-2 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-2 expression has been detected in several different tumor types. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Fam122a C T 19: 24,476,742 M205I probably benign Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Nfkb1 T C 3: 135,594,349 S657G possibly damaging Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr564 A G 7: 102,804,189 K237R probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pde1b A G 15: 103,521,326 D82G probably damaging Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A probably benign Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Usp44 A G 10: 93,847,265 probably benign Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp655 A G 5: 145,244,048 T239A possibly damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Sdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Sdc2 UTSW 15 33017089 splice site probably benign
R1743:Sdc2 UTSW 15 33028078 missense probably benign
R4577:Sdc2 UTSW 15 33017132 missense probably damaging 1.00
R4859:Sdc2 UTSW 15 33032456 missense probably damaging 1.00
R5800:Sdc2 UTSW 15 33028144 missense probably benign 0.02
R5918:Sdc2 UTSW 15 33028167 missense probably benign 0.12
R6782:Sdc2 UTSW 15 33028135 missense probably damaging 0.96
R7757:Sdc2 UTSW 15 33028087 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TCCGGGGTACTGGTTAGTTC -3'
(R):5'- CCTTATGAGTTGCTGTCAGGTG -3'

Sequencing Primer
(F):5'- GTGTGACCCATCCAATAGCTG -3'
(R):5'- CTGAGACTCAGCAAAGTTAGGTTCC -3'
Posted On2015-04-30