Incidental Mutation 'R4032:Fam122a'
ID313563
Institutional Source Beutler Lab
Gene Symbol Fam122a
Ensembl Gene ENSMUSG00000074922
Gene Namefamily with sequence similarity 122, member A
Synonyms2900009I07Rik, Gm9849, 2410124L17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.500) question?
Stock #R4032 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24476502-24477356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24476742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 205 (M205I)
Ref Sequence ENSEMBL: ENSMUSP00000097152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025800] [ENSMUST00000099556] [ENSMUST00000112673]
Predicted Effect probably benign
Transcript: ENSMUST00000025800
SMART Domains Protein: ENSMUSP00000025800
Gene: ENSMUSG00000024867

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 472 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099556
AA Change: M205I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097152
Gene: ENSMUSG00000074922
AA Change: M205I

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 163 187 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112673
SMART Domains Protein: ENSMUSP00000108292
Gene: ENSMUSG00000024867

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 420 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156814
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Nfkb1 T C 3: 135,594,349 S657G possibly damaging Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr564 A G 7: 102,804,189 K237R probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pde1b A G 15: 103,521,326 D82G probably damaging Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sdc2 A T 15: 33,017,177 I46F probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Usp44 A G 10: 93,847,265 probably benign Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp655 A G 5: 145,244,048 T239A possibly damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Fam122a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Fam122a APN 19 24476632 missense probably damaging 1.00
IGL01662:Fam122a APN 19 24476584 missense probably benign 0.00
IGL03070:Fam122a APN 19 24476952 missense probably damaging 1.00
R6164:Fam122a UTSW 19 24477086 missense probably benign 0.00
R7301:Fam122a UTSW 19 24477124 missense probably benign 0.00
R7301:Fam122a UTSW 19 24477346 missense probably damaging 1.00
R7940:Fam122a UTSW 19 24477188 missense probably benign 0.41
Z1177:Fam122a UTSW 19 24476803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATGAGTGAGTCACTTTGAGG -3'
(R):5'- TGGGAAGCAGTGTTTCTCAC -3'

Sequencing Primer
(F):5'- CTTTGAGGAAAGTTCATCTACTGG -3'
(R):5'- ACCGTCCTTGCAAAGTTTTGTGAG -3'
Posted On2015-04-30