Incidental Mutation 'R4033:Als2'
ID313564
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R4033 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59196241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 761 (S761R)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
Predicted Effect probably benign
Transcript: ENSMUST00000027178
AA Change: S761R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: S761R

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159166
Predicted Effect probably benign
Transcript: ENSMUST00000163058
AA Change: S761R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: S761R

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8478:Als2 UTSW 1 59186016 missense probably damaging 0.96
R8492:Als2 UTSW 1 59211344 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGCAAAACTATGGCTGGC -3'
(R):5'- GGTTTGCGTTCCATAGATTAGAAC -3'

Sequencing Primer
(F):5'- CTGCAAAACTATGGCTGGCTAAGG -3'
(R):5'- GCGTTCCATAGATTAGAACTTGTTTC -3'
Posted On2015-04-30